RCHIOBHM_CHR0C25G0500881

No description available

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGGATGGATGGTGTCACGGTCTTGTAGGTGATGGAAGTTTAAGGAGTGAATTGGGCAGTCTTGGAATGGTTTTTGGCCAGGAAGTTATAGGCAATGAATTATCTTGGCTGGGAAGTGATCTTGGCTGGGAAGTGATGCAAATTATGTTCTGGATGTTGCCTATTTATAGGGGAGCATTGGTTGGCTTTTCCAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.12

Weight (kDa)

4.19

Isoelectric Point (pI)

33.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 76
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
AoxI GGCC 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 41
BalI TGGCCA 1 cut(s) 78
BccI CCATC 2 cut(s) 3, 26
BciT130I CCWGG 1 cut(s) 80
Bme1390I CCNGG 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 80
BmsI GCATC 1 cut(s) 126
BsaXI ACNNNNNCTCC 2 cut(s) 165, 195
Bse3DI GCAATG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 80
BseGI GGATG 3 cut(s) 10, 14, 159
BseMI GCAATG 1 cut(s) 100
BseYI CCCAGC 2 cut(s) 109, 126
BshFI GGCC 1 cut(s) 78
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 1 cut(s) 118
BspANI GGCC 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 100
BssMI GATC 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 20
BstF5I GGATG 3 cut(s) 10, 14, 159
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 192
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 3 cut(s) 10, 14, 159
CviJI RGCY 5 cut(s) 78, 109, 126, 186, 195
CviKI_1 RGCY 5 cut(s) 78, 109, 126, 186, 195
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
EaeI YGGCCR 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 78
FaiI YATR 3 cut(s) 89, 146, 168
FokI GGATG 3 cut(s) 17, 21, 166
GsaI CCCAGC 2 cut(s) 113, 130
HaeIII GGCC 1 cut(s) 78
HphI GGTGA 1 cut(s) 41
Hpy188III TCNNGA 1 cut(s) 151
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 192
Kzo9I GATC 1 cut(s) 118
LmnI GCTCC 1 cut(s) 173
LpnPI CCDG 5 cut(s) 65, 92, 95, 112, 136
LweI GCATC 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 14
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MlsI TGGCCA 1 cut(s) 78
MluCI AATT 3 cut(s) 50, 98, 141
MluNI TGGCCA 1 cut(s) 78
Mox20I TGGCCA 1 cut(s) 78
MscI TGGCCA 1 cut(s) 78
MseI TTAA 1 cut(s) 41
Msp20I TGGCCA 1 cut(s) 78
MspA1I CMGCKG 1 cut(s) 195
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 192
NdeII GATC 1 cut(s) 118
NmuCI GTSAC 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 78
PspFI CCCAGC 2 cut(s) 109, 126
PspGI CCWGG 1 cut(s) 78
PvuII CAGCTG 1 cut(s) 195
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 1 cut(s) 118
ScrFI CCNGG 1 cut(s) 80
SetI ASST 2 cut(s) 31, 197
SfaNI GCATC 1 cut(s) 126
Sse9I AATT 3 cut(s) 50, 98, 141
StyD4I CCNGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 20
TasI AATT 3 cut(s) 50, 98, 141
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.