RchiOBHm_Chr6g0257481

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
12861967 .. 12862241
275 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23094

Sequence Viewer

Length: 237 bp
ATGGTTTTTGGCCAGGAAGTGATAGGCAATGAATTATCTTGGCTGGGAAGTGATCTTGGCTGGGAAGTGATGCAAATTCAGTTCTGCACGTTGCCTATTTATAGGGGAGCATTGGTTGGCTTTTGTCGATCATACCCTTCATCATTGGACGGATGGGATCGCATCATAATTCCTTTAATTTCCCAACAGAAACGTCTCCTTTATGGCCTTAATTCCTCTCATAATGGGGTCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.82

Weight (kDa)

5.56

Isoelectric Point (pI)

37.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 165
AcoI YGGCCR 1 cut(s) 10
AcsI RAATTY 1 cut(s) 75
AjnI CCWGG 1 cut(s) 12
Alw26I GTCTC 1 cut(s) 200
AlwI GGATC 1 cut(s) 165
AoxI GGCC 2 cut(s) 10, 205
ApoI RAATTY 1 cut(s) 75
BalI TGGCCA 1 cut(s) 12
BccI CCATC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 14
BcoDI GTCTC 1 cut(s) 200
Bme1390I CCNGG 1 cut(s) 14
BmrFI CCNGG 1 cut(s) 14
BmsI GCATC 2 cut(s) 60, 171
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
Bse3DI GCAATG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 14
BseGI GGATG 1 cut(s) 158
BseMI GCAATG 1 cut(s) 34
BseYI CCCAGC 2 cut(s) 43, 60
BsgI GTGCAG 1 cut(s) 70
BshFI GGCC 2 cut(s) 12, 207
BsmAI GTCTC 1 cut(s) 200
BsmBI CGTCTC 1 cut(s) 200
BsnI GGCC 2 cut(s) 12, 207
Bsp143I GATC 3 cut(s) 52, 128, 157
BspANI GGCC 2 cut(s) 12, 207
BspPI GGATC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 34
BssMI GATC 3 cut(s) 52, 128, 157
Bst2UI CCWGG 1 cut(s) 14
BstF5I GGATG 1 cut(s) 158
BstKTI GATC 3 cut(s) 55, 131, 160
BstMAI GTCTC 1 cut(s) 200
BstMBI GATC 3 cut(s) 52, 128, 157
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 12
BsuRI GGCC 2 cut(s) 12, 207
BtsCI GGATG 1 cut(s) 158
CviJI RGCY 5 cut(s) 12, 43, 60, 120, 207
CviKI_1 RGCY 5 cut(s) 12, 43, 60, 120, 207
DpnI GATC 3 cut(s) 54, 130, 159
DpnII GATC 3 cut(s) 52, 128, 157
EaeI YGGCCR 1 cut(s) 10
EcoRII CCWGG 1 cut(s) 12
Esp3I CGTCTC 1 cut(s) 200
FaiI YATR 5 cut(s) 102, 133, 167, 204, 222
FokI GGATG 1 cut(s) 165
GsaI CCCAGC 2 cut(s) 47, 64
HaeIII GGCC 2 cut(s) 12, 207
HpyAV CCTTC 1 cut(s) 147
HpyCH4IV ACGT 2 cut(s) 89, 193
HpyCH4V TGCA 2 cut(s) 73, 87
HpySE526I ACGT 2 cut(s) 89, 193
Kzo9I GATC 3 cut(s) 52, 128, 157
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 3 cut(s) 26, 29, 46
LweI GCATC 2 cut(s) 60, 171
MaeII ACGT 2 cut(s) 89, 193
MalI GATC 3 cut(s) 54, 130, 159
MboI GATC 3 cut(s) 52, 128, 157
MlsI TGGCCA 1 cut(s) 12
MluCI AATT 5 cut(s) 32, 75, 168, 177, 211
MluNI TGGCCA 1 cut(s) 12
MnlI CCTC 1 cut(s) 226
Mox20I TGGCCA 1 cut(s) 12
MscI TGGCCA 1 cut(s) 12
MseI TTAA 3 cut(s) 176, 210, 235
Msp20I TGGCCA 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
NdeII GATC 3 cut(s) 52, 128, 157
Psp6I CCWGG 1 cut(s) 12
PspFI CCCAGC 2 cut(s) 43, 60
PspGI CCWGG 1 cut(s) 12
SaqAI TTAA 3 cut(s) 176, 210, 235
Sau3AI GATC 3 cut(s) 52, 128, 157
ScrFI CCNGG 1 cut(s) 14
SetI ASST 2 cut(s) 92, 196
SfaNI GCATC 2 cut(s) 60, 171
SgeI CNNG 7 cut(s) 25, 26, 51, 56, 68, 73, 100
Sse9I AATT 5 cut(s) 32, 75, 168, 177, 211
StyD4I CCNGG 1 cut(s) 12
TaiI ACGT 2 cut(s) 92, 196
TaqI TCGA 1 cut(s) 127
TasI AATT 5 cut(s) 32, 75, 168, 177, 211
Tru1I TTAA 3 cut(s) 176, 210, 235
Tru9I TTAA 3 cut(s) 176, 210, 235
TspDTI ATGAA 2 cut(s) 45, 129
TspGWI ACGGA 1 cut(s) 165
XapI RAATTY 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.