Rroxscaffold_1G00030970

beta-galactosidase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
42276906 .. 42283290
6385 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00030970.1

Sequence Viewer

Length: 342 bp
ATGGTCATGGGGTTGAGCAAAAGGAAGGCATGTGCTGACCGTTTTGAGGGGAGATATGATCTTGTACGGTTCATAAGGACAGTACAGAAAGCAGGGCTCTACCTTCATCTGCGAATTGGACCTTATGTTTGTGCAGAATGGAATTTTGGAGGAGAAGTGATAGGCAATGAATTATCTTGGCTGGGAAGTGATCTTGGCTGGGAAGTGATACCAATTCAGTTCTGGACATTGCCTATTTATAGGGGAGCATTGGAAGTGATAGGCAATGAATTATCTTGGCTGGGAAGTGATGCTTGGCTGGGAAGTGATCTTGGCTGGGAAGTGATCTTGGCTGGGAAGTGA

Protein Analysis

113

Amino Acids

12.75

Weight (kDa)

5.33

Isoelectric Point (pI)

18.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_35 PF01301 13 - 51 1.7e-15 Glycosyl hydrolases family 35
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 142
AfaI GTAC 2 cut(s) 66, 84
AfiI CCNNNNNNNGG 1 cut(s) 46
AjuI GAANNNNNNNTTGG 4 cut(s) 129, 161, 277, 309
ApoI RAATTY 1 cut(s) 142
ArsI GACNNNNNNTTYG 2 cut(s) 111, 143
AspS9I GGNCC 1 cut(s) 119
AvaII GGWCC 1 cut(s) 119
BanII GRGCYC 1 cut(s) 99
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmsI GCATC 1 cut(s) 280
BsaXI ACNNNNNCTCC 2 cut(s) 141, 171
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse3DI GCAATG 3 cut(s) 172, 227, 271
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMI GCAATG 3 cut(s) 172, 227, 271
BseRI GAGGAG 1 cut(s) 165
BseYI CCCAGC 6 cut(s) 181, 198, 280, 298, 315, 332
BsgI GTGCAG 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 46
Bsp1286I GDGCHC 1 cut(s) 99
Bsp143I GATC 4 cut(s) 58, 190, 307, 324
BsrDI GCAATG 3 cut(s) 172, 227, 271
BssMI GATC 4 cut(s) 58, 190, 307, 324
Bst4CI ACNGT 3 cut(s) 41, 69, 82
BstKTI GATC 4 cut(s) 61, 193, 310, 327
BstMBI GATC 4 cut(s) 58, 190, 307, 324
BstNSI RCATGY 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 119
Csp6I GTAC 2 cut(s) 65, 83
CviAII CATG 2 cut(s) 7, 30
CviJI RGCY 7 cut(s) 97, 181, 198, 280, 298, 315, 332
CviKI_1 RGCY 7 cut(s) 97, 181, 198, 280, 298, 315, 332
CviQI GTAC 2 cut(s) 65, 83
DpnI GATC 4 cut(s) 60, 192, 309, 326
DpnII GATC 4 cut(s) 58, 190, 307, 324
Eco24I GRGCYC 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 119
EcoT38I GRGCYC 1 cut(s) 99
FaeI CATG 2 cut(s) 10, 33
FaiI YATR 6 cut(s) 8, 31, 57, 74, 126, 240
FalI AAGNNNNNCTT 2 cut(s) 277, 309
FatI CATG 2 cut(s) 6, 29
FriOI GRGCYC 1 cut(s) 99
GsaI CCCAGC 6 cut(s) 185, 202, 284, 302, 319, 336
Hin1II CATG 2 cut(s) 10, 33
Hpy188III TCNNGA 1 cut(s) 223
HpyAV CCTTC 2 cut(s) 19, 113
HpyCH4III ACNGT 3 cut(s) 41, 69, 82
HpyCH4V TGCA 1 cut(s) 134
Hsp92II CATG 2 cut(s) 10, 33
Kzo9I GATC 4 cut(s) 58, 190, 307, 324
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 8 cut(s) 78, 167, 184, 208, 266, 284, 301, 318
LweI GCATC 1 cut(s) 280
MalI GATC 4 cut(s) 60, 192, 309, 326
MboI GATC 4 cut(s) 58, 190, 307, 324
MhlI GDGCHC 1 cut(s) 99
MluCI AATT 5 cut(s) 114, 142, 170, 213, 269
MnlI CCTC 2 cut(s) 40, 143
NdeII GATC 4 cut(s) 58, 190, 307, 324
NlaIII CATG 2 cut(s) 10, 33
NspI RCATGY 1 cut(s) 33
PspFI CCCAGC 6 cut(s) 181, 198, 280, 298, 315, 332
PspPI GGNCC 1 cut(s) 119
RsaI GTAC 2 cut(s) 66, 84
RsaNI GTAC 2 cut(s) 65, 83
Sau3AI GATC 4 cut(s) 58, 190, 307, 324
Sau96I GGNCC 1 cut(s) 119
SduI GDGCHC 1 cut(s) 99
SetI ASST 2 cut(s) 105, 124
SfaNI GCATC 1 cut(s) 280
SinI GGWCC 1 cut(s) 119
Sse9I AATT 5 cut(s) 114, 142, 170, 213, 269
TaaI ACNGT 3 cut(s) 41, 69, 82
TasI AATT 5 cut(s) 114, 142, 170, 213, 269
TatI WGTACW 1 cut(s) 82
TspDTI ATGAA 4 cut(s) 61, 95, 183, 282
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 1 cut(s) 142
XceI RCATGY 1 cut(s) 33
XcmI CCANNNNNNNNNTGG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.