Rroxscaffold_7G00183160

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001950
Physical Location & Seq
Forward (+)
22234510 .. 22265465
30956 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00183160.1

Sequence Viewer

Length: 633 bp
ATGGATGGATGGTGTCACGGTCTTGTAGGAGATGGAAGTTTAAGGAGTGAATTGGGCAGCCTTGGAATGGTTTTTGGCCAGGAAGTGATAGGCAATGAATTATCTTGGCTGGGAAGTGATCTTGGTGGGAACTTTAATGATTTGCTCCAAGGGACTGTGCGGCCCGAGGATCGAAGATCCAACGACACTCTCCCACCTAAAGATCAAAGCCGGCTAAGGGTGTCGAACATGGCCATGTTGGCGGACGATCTTTCACAAACAAATACCATAGAATTGGGTCCTGGATCCAATACCGGTAAAGCACGGGAGCCCCAATCCATTCTAGCAAATCATAAAAATTATGACAAAGATTGTAGGCTGCAGGCCAAAACCAAACTCCACCCGGATCCCGGATCCGACACCATTTGTCAAGCCCACCTAGATCCTAGTGCCGGCGATCCGGACAGCGGCACCGTCGGAAGCGGCCCTATGACCTACAATGGAAGAGAGCGCCAAACTGCGATAGCCATCGCCGACGAACAAAACGCCGCCATCAAAGTCCCAACAAGCCGACACTACCGCTCGACCATCACCATCGAATCCAATCCCCTCACCTCGCACCGAATCCGACATTCTTCAACCCCGTCGCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

210

Amino Acids

22.64

Weight (kDa)

5.77

Isoelectric Point (pI)

49.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 449
AccBSI CCGCTC 1 cut(s) 561
AccIII TCCGGA 1 cut(s) 439
AciI CCGC 6 cut(s) 160, 242, 447, 462, 528, 559
AcoI YGGCCR 2 cut(s) 76, 231
AfiI CCNNNNNNNGG 5 cut(s) 67, 217, 389, 431, 446
AgeI ACCGGT 1 cut(s) 293
AgsI TTSAA 1 cut(s) 618
AjnI CCWGG 2 cut(s) 78, 280
Ama87I CYCGRG 1 cut(s) 164
Aor13HI TCCGGA 1 cut(s) 439
AoxI GGCC 5 cut(s) 76, 161, 231, 363, 463
ApeKI GCWGC 2 cut(s) 57, 358
AsiGI ACCGGT 1 cut(s) 293
AspLEI GCGC 1 cut(s) 492
AspS9I GGNCC 3 cut(s) 162, 278, 464
AsuC2I CCSGG 2 cut(s) 383, 390
AsuHPI GGTGA 2 cut(s) 562, 583
AvaI CYCGRG 1 cut(s) 164
AvaII GGWCC 1 cut(s) 278
BalI TGGCCA 2 cut(s) 78, 233
BamHI GGATCC 3 cut(s) 284, 385, 392
BanI GGYRCC 1 cut(s) 449
BanII GRGCYC 1 cut(s) 312
BbvI GCAGC 2 cut(s) 69, 345
BccI CCATC 6 cut(s) 3, 26, 515, 539, 575, 581
BceAI ACGGC 1 cut(s) 613
BciT130I CCWGG 2 cut(s) 80, 282
BcnI CCSGG 2 cut(s) 383, 390
BfaI CTAG 3 cut(s) 323, 419, 426
BfmI CTRYAG 1 cut(s) 359
BfoI RGCGCY 1 cut(s) 493
BglI GCCNNNNNGGC 1 cut(s) 239
BisI GCNGC 6 cut(s) 58, 161, 359, 448, 463, 528
BlsI GCNGC 6 cut(s) 59, 162, 360, 449, 464, 529
Bme1390I CCNGG 4 cut(s) 80, 282, 383, 390
Bme18I GGWCC 1 cut(s) 278
BmeT110I CYCGRG 1 cut(s) 164
BmgT120I GGNCC 3 cut(s) 162, 278, 464
BmiI GGNNCC 6 cut(s) 279, 286, 309, 387, 394, 451
BmrFI CCNGG 4 cut(s) 80, 282, 383, 390
Bpu10I CCTNAGC 1 cut(s) 215
BpuMI CCSGG 2 cut(s) 383, 390
BsaBI GATNNNNATC 1 cut(s) 506
BsaJI CCNNGG 3 cut(s) 61, 148, 165
BsaWI WCCGGW 2 cut(s) 293, 439
Bsc4I CCNNNNNNNGG 5 cut(s) 67, 217, 389, 431, 446
Bse118I RCCGGY 3 cut(s) 210, 293, 431
Bse3DI GCAATG 1 cut(s) 100
Bse8I GATNNNNATC 1 cut(s) 506
BseAI TCCGGA 1 cut(s) 439
BseBI CCWGG 2 cut(s) 80, 282
BseDI CCNNGG 3 cut(s) 61, 148, 165
BseGI GGATG 2 cut(s) 10, 14
BseJI GATNNNNATC 1 cut(s) 506
BseLI CCNNNNNNNGG 5 cut(s) 67, 217, 389, 431, 446
BseMI GCAATG 1 cut(s) 100
BseXI GCAGC 2 cut(s) 69, 345
BseYI CCCAGC 1 cut(s) 109
BshFI GGCC 5 cut(s) 78, 163, 233, 365, 465
BshNI GGYRCC 1 cut(s) 449
BshTI ACCGGT 1 cut(s) 293
BsiHKCI CYCGRG 1 cut(s) 164
BsiSI CCGG 6 cut(s) 211, 294, 383, 390, 432, 440
BslFI GGGAC 2 cut(s) 166, 524
BslI CCNNNNNNNGG 5 cut(s) 67, 217, 389, 431, 446
BsmFI GGGAC 2 cut(s) 166, 524
BsnI GGCC 5 cut(s) 78, 163, 233, 365, 465
BsoBI CYCGRG 1 cut(s) 164
Bsp1286I GDGCHC 1 cut(s) 312
Bsp13I TCCGGA 1 cut(s) 439
BspACI CCGC 6 cut(s) 160, 242, 447, 462, 528, 559
BspANI GGCC 5 cut(s) 78, 163, 233, 365, 465
BspEI TCCGGA 1 cut(s) 439
BspLI GGNNCC 6 cut(s) 279, 286, 309, 387, 394, 451
BspMAI CTGCAG 1 cut(s) 363
BspT107I GGYRCC 1 cut(s) 449
BsrBI CCGCTC 1 cut(s) 561
BsrDI GCAATG 1 cut(s) 100
BsrFI RCCGGY 3 cut(s) 210, 293, 431
BssAI RCCGGY 3 cut(s) 210, 293, 431
BssECI CCNNGG 3 cut(s) 61, 148, 165
BssT1I CCWWGG 2 cut(s) 61, 148
Bst2UI CCWGG 2 cut(s) 80, 282
Bst4CI ACNGT 3 cut(s) 20, 157, 454
Bst6I CTCTTC 1 cut(s) 478
BstC8I GCNNGC 3 cut(s) 212, 363, 433
BstDEI CTNAG 1 cut(s) 215
BstF5I GGATG 2 cut(s) 10, 14
BstH2I RGCGCY 1 cut(s) 493
BstHHI GCGC 1 cut(s) 492
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 2 cut(s) 80, 282
BstSCI CCNGG 4 cut(s) 78, 280, 381, 388
BstSFI CTRYAG 1 cut(s) 359
BstV1I GCAGC 2 cut(s) 69, 345
BstX2I RGATCY 5 cut(s) 176, 284, 385, 392, 421
BstXI CCANNNNNNTGG 1 cut(s) 274
BstYI RGATCY 5 cut(s) 176, 284, 385, 392, 421
BsuRI GGCC 5 cut(s) 78, 163, 233, 365, 465
BtgZI GCGATG 1 cut(s) 493
BtsCI GGATG 2 cut(s) 10, 14
Cac8I GCNNGC 3 cut(s) 212, 363, 433
CfoI GCGC 1 cut(s) 492
Cfr10I RCCGGY 3 cut(s) 210, 293, 431
Cfr13I GGNCC 3 cut(s) 162, 278, 464
CspAI ACCGGT 1 cut(s) 293
CviAII CATG 2 cut(s) 229, 235
DdeI CTNAG 1 cut(s) 215
EaeI YGGCCR 2 cut(s) 76, 231
Eam1104I CTCTTC 1 cut(s) 478
EarI CTCTTC 1 cut(s) 478
EciI GGCGGA 1 cut(s) 257
Eco130I CCWWGG 2 cut(s) 61, 148
Eco24I GRGCYC 1 cut(s) 312
Eco47I GGWCC 1 cut(s) 278
Eco88I CYCGRG 1 cut(s) 164
EcoO109I RGGNCCY 1 cut(s) 278
EcoRII CCWGG 2 cut(s) 78, 280
EcoT14I CCWWGG 2 cut(s) 61, 148
EcoT38I GRGCYC 1 cut(s) 312
ErhI CCWWGG 2 cut(s) 61, 148
FaeI CATG 2 cut(s) 232, 238
FaiI YATR 6 cut(s) 230, 236, 269, 333, 342, 470
FaqI GGGAC 2 cut(s) 166, 524
FatI CATG 2 cut(s) 228, 234
Fnu4HI GCNGC 6 cut(s) 58, 161, 359, 448, 463, 528
FokI GGATG 2 cut(s) 17, 21
FriOI GRGCYC 1 cut(s) 312
Fsp4HI GCNGC 6 cut(s) 58, 161, 359, 448, 463, 528
FspBI CTAG 3 cut(s) 323, 419, 426
GlaI GCGC 1 cut(s) 491
GluI GCNGC 6 cut(s) 58, 161, 359, 448, 463, 528
GsaI CCCAGC 1 cut(s) 113
HaeII RGCGCY 1 cut(s) 493
HaeIII GGCC 5 cut(s) 78, 163, 233, 365, 465
HapII CCGG 6 cut(s) 211, 294, 383, 390, 432, 440
HhaI GCGC 1 cut(s) 492
Hin1II CATG 2 cut(s) 232, 238
Hin6I GCGC 1 cut(s) 490
HinP1I GCGC 1 cut(s) 490
HinfI GANTC 2 cut(s) 578, 603
HpaII CCGG 6 cut(s) 211, 294, 383, 390, 432, 440
HphI GGTGA 2 cut(s) 562, 583
Hpy188I TCNGA 3 cut(s) 397, 458, 608
Hpy188III TCNNGA 1 cut(s) 440
Hpy99I CGWCG 3 cut(s) 458, 518, 628
HpyCH4III ACNGT 3 cut(s) 20, 157, 454
HpyCH4V TGCA 1 cut(s) 361
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpyF3I CTNAG 1 cut(s) 215
Hsp92II CATG 2 cut(s) 232, 238
HspAI GCGC 1 cut(s) 490
Kpn2I TCCGGA 1 cut(s) 439
KroI GCCGGC 2 cut(s) 210, 431
KroNI GCCGGC 2 cut(s) 212, 433
LmnI GCTCC 2 cut(s) 150, 307
Lsp1109I GCAGC 2 cut(s) 69, 345
MaeI CTAG 3 cut(s) 323, 419, 426
MaeIII GTNAC 1 cut(s) 14
MbiI CCGCTC 1 cut(s) 561
MboII GAAGA 3 cut(s) 186, 495, 606
MflI RGATCY 5 cut(s) 176, 284, 385, 392, 421
MhlI GDGCHC 1 cut(s) 312
MlsI TGGCCA 2 cut(s) 78, 233
MluCI AATT 4 cut(s) 50, 98, 272, 337
MluNI TGGCCA 2 cut(s) 78, 233
MmeI TCCRAC 4 cut(s) 204, 420, 436, 631
MnlI CCTC 3 cut(s) 160, 599, 604
Mox20I TGGCCA 2 cut(s) 78, 233
MroI TCCGGA 1 cut(s) 439
MroNI GCCGGC 2 cut(s) 210, 431
MscI TGGCCA 2 cut(s) 78, 233
MseI TTAA 2 cut(s) 41, 135
MslI CAYNNNNRTG 1 cut(s) 233
Msp20I TGGCCA 2 cut(s) 78, 233
MspA1I CMGCKG 1 cut(s) 447
MspI CCGG 6 cut(s) 211, 294, 383, 390, 432, 440
MspR9I CCNGG 4 cut(s) 80, 282, 383, 390
MvaI CCWGG 2 cut(s) 80, 282
MwoI GCNNNNNNNGC 1 cut(s) 239
NaeI GCCGGC 2 cut(s) 212, 433
NciI CCSGG 2 cut(s) 383, 390
NgoMIV GCCGGC 2 cut(s) 210, 431
NlaIII CATG 2 cut(s) 232, 238
NlaIV GGNNCC 6 cut(s) 279, 286, 309, 387, 394, 451
NmuCI GTSAC 1 cut(s) 14
PdiI GCCGGC 2 cut(s) 212, 433
PfeI GAWTC 2 cut(s) 578, 603
PfoI TCCNGGA 2 cut(s) 280, 388
PinAI ACCGGT 1 cut(s) 293
PkrI GCNGC 6 cut(s) 59, 162, 360, 449, 464, 529
PpuMI RGGWCCY 1 cut(s) 278
Psp5II RGGWCCY 1 cut(s) 278
Psp6I CCWGG 2 cut(s) 78, 280
PspFI CCCAGC 1 cut(s) 109
PspGI CCWGG 2 cut(s) 78, 280
PspN4I GGNNCC 6 cut(s) 279, 286, 309, 387, 394, 451
PspPI GGNCC 3 cut(s) 162, 278, 464
PspPPI RGGWCCY 1 cut(s) 278
PstI CTGCAG 1 cut(s) 363
PsuI RGATCY 5 cut(s) 176, 284, 385, 392, 421
RseI CAYNNNNRTG 1 cut(s) 233
SaqAI TTAA 2 cut(s) 41, 135
SatI GCNGC 6 cut(s) 58, 161, 359, 448, 463, 528
Sau96I GGNCC 3 cut(s) 162, 278, 464
ScrFI CCNGG 4 cut(s) 80, 282, 383, 390
SduI GDGCHC 1 cut(s) 312
SetI ASST 4 cut(s) 199, 420, 476, 596
SfcI CTRYAG 1 cut(s) 359
SinI GGWCC 1 cut(s) 278
SmiMI CAYNNNNRTG 1 cut(s) 233
Sse9I AATT 4 cut(s) 50, 98, 272, 337
SsiI CCGC 6 cut(s) 160, 242, 447, 462, 528, 559
SspMI CTAG 3 cut(s) 323, 419, 426
StyD4I CCNGG 4 cut(s) 78, 280, 381, 388
StyI CCWWGG 2 cut(s) 61, 148
TaaI ACNGT 3 cut(s) 20, 157, 454
TaqI TCGA 4 cut(s) 172, 224, 563, 576
TasI AATT 4 cut(s) 50, 98, 272, 337
TauI GCSGC 4 cut(s) 163, 450, 465, 530
TfiI GAWTC 2 cut(s) 578, 603
Tru1I TTAA 2 cut(s) 41, 135
Tru9I TTAA 2 cut(s) 41, 135
TseFI GTSAC 1 cut(s) 14
TseI GCWGC 2 cut(s) 57, 358
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 278
XspI CTAG 3 cut(s) 323, 419, 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.