pycom111g03560

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
Physical Location & Seq
Forward (+)
2188231 .. 2188663
433 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom111g03560.2

Sequence Viewer

Length: 231 bp
ATGCAGAAGGCAGGGCTCTATGCTCACCTTCACATTGGCCCTTATGTTTGTGTTGAGGGGCTCTCGGAGAAGCATGTAATGGAGACACCACTTCTGTCATTATCTTTGGAAGTATTTGATGGTCAACTGGATGATCCTATTAGCATGTCCATCCGAGGAGGTTTGTATTCATCTTTCCACTTTTTTAGAAAAATGTTTAGAAATCATAAAGATGCTTCTGAAGATAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.68

Weight (kDa)

6.16

Isoelectric Point (pI)

40.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 77
AlwI GGATC 1 cut(s) 128
AoxI GGCC 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 17
BanII GRGCYC 2 cut(s) 18, 63
BccI CCATC 2 cut(s) 113, 158
BcoDI GTCTC 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 38
BmsI GCATC 1 cut(s) 202
BplI GAGNNNNNCTC 2 cut(s) 47, 79
BsaJI CCNNGG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 154
BseGI GGATG 2 cut(s) 136, 150
BseNI ACTGG 1 cut(s) 132
BseRI GAGGAG 1 cut(s) 171
BshFI GGCC 1 cut(s) 39
BsmAI GTCTC 1 cut(s) 77
BsnI GGCC 1 cut(s) 39
Bsp1286I GDGCHC 2 cut(s) 18, 63
Bsp143I GATC 1 cut(s) 133
BspANI GGCC 1 cut(s) 39
BspPI GGATC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 1 cut(s) 133
BstF5I GGATG 2 cut(s) 136, 150
BstKTI GATC 1 cut(s) 136
BstMAI GTCTC 1 cut(s) 77
BstMBI GATC 1 cut(s) 133
BstNSI RCATGY 2 cut(s) 77, 148
BsuRI GGCC 1 cut(s) 39
BtsCI GGATG 2 cut(s) 136, 150
Cfr13I GGNCC 1 cut(s) 38
CviAII CATG 2 cut(s) 74, 145
CviJI RGCY 3 cut(s) 16, 39, 61
CviKI_1 RGCY 3 cut(s) 16, 39, 61
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eco24I GRGCYC 2 cut(s) 18, 63
EcoT38I GRGCYC 2 cut(s) 18, 63
FaeI CATG 2 cut(s) 77, 148
FaiI YATR 5 cut(s) 21, 45, 75, 146, 207
FatI CATG 2 cut(s) 73, 144
FokI GGATG 2 cut(s) 137, 143
FriOI GRGCYC 2 cut(s) 18, 63
HaeIII GGCC 1 cut(s) 39
Hin1II CATG 2 cut(s) 77, 148
HincII GTYRAC 1 cut(s) 125
HindII GTYRAC 1 cut(s) 125
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 125
Hpy188I TCNGA 3 cut(s) 67, 155, 220
Hpy8I GTNNAC 1 cut(s) 125
HpyAV CCTTC 1 cut(s) 38
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 2 cut(s) 77, 148
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 1 cut(s) 113
LweI GCATC 1 cut(s) 202
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MhlI GDGCHC 2 cut(s) 18, 63
MnlI CCTC 3 cut(s) 49, 149, 152
MslI CAYNNNNRTG 1 cut(s) 210
NdeII GATC 1 cut(s) 133
NlaIII CATG 2 cut(s) 77, 148
NspI RCATGY 2 cut(s) 77, 148
PspPI GGNCC 1 cut(s) 38
RseI CAYNNNNRTG 1 cut(s) 210
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 38
SduI GDGCHC 2 cut(s) 18, 63
SetI ASST 3 cut(s) 30, 163, 230
SfaNI GCATC 1 cut(s) 202
SgeI CNNG 6 cut(s) 24, 76, 86, 140, 157, 167
SmiMI CAYNNNNRTG 1 cut(s) 210
TspDTI ATGAA 1 cut(s) 159
XceI RCATGY 2 cut(s) 77, 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.