MD15G1297200.v1.1

U4 U6 small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
28024170 .. 28025226
1057 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1297200.v1.1.491

Sequence Viewer

Length: 315 bp
ATGTTTGAAGATGATGTTGACGCTGGAATTATGGAAGAAGATGTTGATGGGGACTTGGCTGATTTAGAAACACTTAATTATGATGATCTGGACAGTGTTTCAAAATTGCAGAAATCACAAAGATATACAGATATAATACAGAAAGTGGAAGTTTTGGAAGATGATCCAGAAGACCAGCTGATTGTGGACTGTAATGCTTTGTCTGTTGACATTGAGAACGAAATTGTAATCATCCATAATTTTATTCGGGACAAGTATCGCCCAAAATTTCCAGAGCTGGAATCACTTGTGCATCATCCAATTGATTATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.04

Weight (kDa)

4.05

Isoelectric Point (pI)

33.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nop PF01798 68 - 104 1.3e-09 snoRNA binding domain, fibrillarin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 266
AgsI TTSAA 2 cut(s) 8, 102
AluBI AGCT 2 cut(s) 178, 277
AluI AGCT 2 cut(s) 178, 277
AlwI GGATC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 266
BbsI GAAGAC 1 cut(s) 177
BccI CCATC 1 cut(s) 41
BmsI GCATC 1 cut(s) 301
BpiI GAAGAC 1 cut(s) 177
BseGI GGATG 2 cut(s) 231, 295
BslFI GGGAC 2 cut(s) 65, 263
BsmFI GGGAC 2 cut(s) 65, 263
Bsp143I GATC 2 cut(s) 85, 163
BspPI GGATC 1 cut(s) 158
BssMI GATC 2 cut(s) 85, 163
Bst4CI ACNGT 2 cut(s) 95, 191
BstF5I GGATG 2 cut(s) 231, 295
BstKTI GATC 2 cut(s) 88, 166
BstMBI GATC 2 cut(s) 85, 163
BstV2I GAAGAC 1 cut(s) 177
BtsCI GGATG 2 cut(s) 231, 295
BtsIMutI CAGTG 1 cut(s) 100
CseI GACGC 1 cut(s) 29
CviJI RGCY 3 cut(s) 59, 178, 277
CviKI_1 RGCY 3 cut(s) 59, 178, 277
DpnI GATC 2 cut(s) 87, 165
DpnII GATC 2 cut(s) 85, 163
FaiI YATR 6 cut(s) 32, 81, 126, 134, 237, 309
FaqI GGGAC 2 cut(s) 65, 263
FokI GGATG 2 cut(s) 218, 282
HgaI GACGC 1 cut(s) 29
HincII GTYRAC 2 cut(s) 19, 208
HindII GTYRAC 2 cut(s) 19, 208
HinfI GANTC 1 cut(s) 281
Hpy166II GTNNAC 3 cut(s) 19, 187, 208
Hpy188III TCNNGA 4 cut(s) 89, 167, 248, 272
Hpy8I GTNNAC 3 cut(s) 19, 187, 208
HpyCH4III ACNGT 2 cut(s) 95, 191
HpyCH4V TGCA 2 cut(s) 109, 292
Kzo9I GATC 2 cut(s) 85, 163
LpnPI CCDG 6 cut(s) 9, 74, 180, 188, 263, 285
LweI GCATC 1 cut(s) 301
MalI GATC 2 cut(s) 87, 165
MboI GATC 2 cut(s) 85, 163
MboII GAAGA 5 cut(s) 20, 47, 50, 170, 182
MfeI CAATTG 1 cut(s) 300
MluCI AATT 7 cut(s) 27, 76, 104, 222, 238, 266, 300
MseI TTAA 1 cut(s) 75
MspA1I CMGCKG 1 cut(s) 178
MunI CAATTG 1 cut(s) 300
NdeII GATC 2 cut(s) 85, 163
PfeI GAWTC 1 cut(s) 281
PvuII CAGCTG 1 cut(s) 178
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 2 cut(s) 85, 163
SetI ASST 2 cut(s) 180, 279
SfaNI GCATC 1 cut(s) 301
Sse9I AATT 7 cut(s) 27, 76, 104, 222, 238, 266, 300
TaaI ACNGT 2 cut(s) 95, 191
TasI AATT 7 cut(s) 27, 76, 104, 222, 238, 266, 300
TfiI GAWTC 1 cut(s) 281
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 100
TspRI CASTG 1 cut(s) 100
XapI RAATTY 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.