RchiOBHm_Chr2g0166471

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
81121376 .. 81124744
3369 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53435

Sequence Viewer

Length: 243 bp
ATGGAGCAAGATGTCAATGGTGCTTCAGATTTTCTACCAATAAAGAAAATCAAGATTTTCTGTAGTCTTGGAGAGGAACATGCAACTCATGCTCACCACTCCGACCGCAATATCCAAGAAAATCTGGTAGCCAAGCTCCTAAAATATGTTGAGTGGGCAACATGGGATTGTGGTTGTTATAACATAGGTAATATCAGGGAAGGGCTGATTTGTGACAGGATAGGGATTGGCTTACATTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.05

Weight (kDa)

5.88

Isoelectric Point (pI)

21.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 180
AciI CCGC 1 cut(s) 106
AcuI CTGAAG 1 cut(s) 9
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 86
BfmI CTRYAG 1 cut(s) 61
Bse3DI GCAATG 1 cut(s) 235
BseMI GCAATG 1 cut(s) 235
Bsh1285I CGRYCG 1 cut(s) 106
BsiEI CGRYCG 1 cut(s) 106
BspACI CCGC 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 235
BstAPI GCANNNNNTGC 1 cut(s) 89
BstMCI CGRYCG 1 cut(s) 106
BstMWI GCNNNNNNNGC 2 cut(s) 89, 237
BstNSI RCATGY 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 61
CviAII CATG 3 cut(s) 80, 89, 162
CviJI RGCY 4 cut(s) 131, 136, 205, 231
CviKI_1 RGCY 4 cut(s) 131, 136, 205, 231
Eco57I CTGAAG 1 cut(s) 9
FaeI CATG 3 cut(s) 83, 92, 165
FaiI YATR 6 cut(s) 81, 90, 147, 163, 180, 185
FatI CATG 3 cut(s) 79, 88, 161
Hin1II CATG 3 cut(s) 83, 92, 165
HphI GGTGA 1 cut(s) 86
Hpy188I TCNGA 2 cut(s) 28, 103
Hpy188III TCNNGA 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 194
HpyCH4V TGCA 1 cut(s) 83
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 237
Hsp92II CATG 3 cut(s) 83, 92, 165
LmnI GCTCC 2 cut(s) 4, 141
LpnPI CCDG 3 cut(s) 110, 181, 202
MaeIII GTNAC 1 cut(s) 212
MmeI TCCRAC 1 cut(s) 126
MnlI CCTC 1 cut(s) 67
MwoI GCNNNNNNNGC 2 cut(s) 89, 237
NlaIII CATG 3 cut(s) 83, 92, 165
NmuCI GTSAC 1 cut(s) 212
NspI RCATGY 1 cut(s) 83
PsiI TTATAA 1 cut(s) 180
SetI ASST 2 cut(s) 138, 190
SfcI CTRYAG 1 cut(s) 61
SsiI CCGC 1 cut(s) 106
TseFI GTSAC 1 cut(s) 212
Tsp45I GTSAC 1 cut(s) 212
XceI RCATGY 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.