Rh4DG178400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
35326450 .. 35331118
4669 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG178400.1

Sequence Viewer

Length: 477 bp
ATGCTTTCCGTGTTGAATAACCGCAGTTCCTTCCTAGAAGATTACATTTGTCATCAAAACTTGATAACTAAAGACTCACACTTGGGCAGGATAAAACTAATTGTTCAATCCTTCGAATCATTACTTTCACCAATAGTACTATCTCCTACAATCAAAAACCTATCCATCCAAGCCAGCCAGCAAAATTTAGCTAGGGCTTTTAATGATTTCCAACAAAATTTAGCTGGCAAGTTTGAATGGATCGGTTCTCGACAGTGGCACATAGTAAGAATTAGTTATGACAGAATATCAAGTAAAACCAACTGTCCACAGCTTAAGGAAATGACCACTGTCAGCTTTGATGGTGCTGCACTTGCACAAATTCCTCAAGCAACCATCATAAGTTGGCACAATCCAGCAAATCATTCTAGCAGCTGCATTTACAACAGCTTTGAATTTAGCTGCTACATTCATTTGCTAAAGCCACTGCAATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

158

Amino Acids

18.03

Weight (kDa)

8.73

Isoelectric Point (pI)

49.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 22
AclWI GGATC 1 cut(s) 248
AcsI RAATTY 4 cut(s) 184, 217, 360, 434
AfaI GTAC 1 cut(s) 138
AflII CTTAAG 1 cut(s) 314
AgsI TTSAA 4 cut(s) 16, 107, 236, 434
AluBI AGCT 7 cut(s) 191, 224, 313, 336, 414, 429, 441
AluI AGCT 7 cut(s) 191, 224, 313, 336, 414, 429, 441
AlwI GGATC 1 cut(s) 248
ApeKI GCWGC 4 cut(s) 347, 411, 414, 441
ApoI RAATTY 4 cut(s) 184, 217, 360, 434
AsuHPI GGTGA 1 cut(s) 120
AsuII TTCGAA 1 cut(s) 114
BbvI GCAGC 4 cut(s) 334, 401, 423, 428
BccI CCATC 3 cut(s) 173, 335, 383
BfaI CTAG 3 cut(s) 35, 192, 408
BfrI CTTAAG 1 cut(s) 314
BisI GCNGC 4 cut(s) 348, 412, 415, 442
BlsI GCNGC 4 cut(s) 349, 413, 416, 443
BmcAI AGTACT 1 cut(s) 138
BoxI GACNNNNGTC 1 cut(s) 329
Bpu14I TTCGAA 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 351
BseGI GGATG 1 cut(s) 165
BseXI GCAGC 4 cut(s) 334, 401, 423, 428
BsgI GTGCAG 1 cut(s) 333
Bsp119I TTCGAA 1 cut(s) 114
Bsp143I GATC 1 cut(s) 240
BspACI CCGC 1 cut(s) 22
BspPI GGATC 1 cut(s) 248
BspT104I TTCGAA 1 cut(s) 114
BspTI CTTAAG 1 cut(s) 314
BssMI GATC 1 cut(s) 240
Bst4CI ACNGT 3 cut(s) 255, 305, 331
BstAFI CTTAAG 1 cut(s) 314
BstBI TTCGAA 1 cut(s) 114
BstC8I GCNNGC 3 cut(s) 175, 179, 226
BstF5I GGATG 1 cut(s) 165
BstKTI GATC 1 cut(s) 243
BstMBI GATC 1 cut(s) 240
BstMWI GCNNNNNNNGC 1 cut(s) 353
BstPAI GACNNNNGTC 1 cut(s) 329
BstV1I GCAGC 4 cut(s) 334, 401, 423, 428
BtsCI GGATG 1 cut(s) 165
BtsI GCAGTG 1 cut(s) 464
BtsIMutI CAGTG 3 cut(s) 260, 327, 464
Cac8I GCNNGC 3 cut(s) 175, 179, 226
Csp6I GTAC 1 cut(s) 137
CviQI GTAC 1 cut(s) 137
DpnI GATC 1 cut(s) 242
DpnII GATC 1 cut(s) 240
FaiI YATR 3 cut(s) 263, 279, 380
Fnu4HI GCNGC 4 cut(s) 348, 412, 415, 442
FokI GGATG 1 cut(s) 152
Fsp4HI GCNGC 4 cut(s) 348, 412, 415, 442
FspBI CTAG 3 cut(s) 35, 192, 408
GluI GCNGC 4 cut(s) 348, 412, 415, 442
HinfI GANTC 2 cut(s) 74, 116
HphI GGTGA 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 308
Hpy188III TCNNGA 1 cut(s) 249
Hpy8I GTNNAC 1 cut(s) 308
HpyAV CCTTC 2 cut(s) 40, 121
HpyCH4III ACNGT 3 cut(s) 255, 305, 331
HpyCH4V TGCA 4 cut(s) 350, 356, 417, 469
HpyF10VI GCNNNNNNNGC 1 cut(s) 353
Kzo9I GATC 1 cut(s) 240
LpnPI CCDG 5 cut(s) 73, 187, 191, 210, 408
Lsp1109I GCAGC 4 cut(s) 334, 401, 423, 428
MaeI CTAG 3 cut(s) 35, 192, 408
MalI GATC 1 cut(s) 242
MboI GATC 1 cut(s) 240
MboII GAAGA 1 cut(s) 50
MluCI AATT 6 cut(s) 99, 184, 217, 270, 360, 434
MlyI GAGTC 1 cut(s) 68
MmeI TCCRAC 1 cut(s) 235
MnlI CCTC 1 cut(s) 375
MseI TTAA 3 cut(s) 201, 315, 475
MspA1I CMGCKG 1 cut(s) 414
MspCI CTTAAG 1 cut(s) 314
MwoI GCNNNNNNNGC 1 cut(s) 353
NdeII GATC 1 cut(s) 240
NspV TTCGAA 1 cut(s) 114
PfeI GAWTC 1 cut(s) 116
PkrI GCNGC 4 cut(s) 349, 413, 416, 443
PleI GAGTC 1 cut(s) 68
PpsI GAGTC 1 cut(s) 68
PshAI GACNNNNGTC 1 cut(s) 329
PvuII CAGCTG 1 cut(s) 414
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
SaqAI TTAA 3 cut(s) 201, 315, 475
SatI GCNGC 4 cut(s) 348, 412, 415, 442
Sau3AI GATC 1 cut(s) 240
ScaI AGTACT 1 cut(s) 138
SchI GAGTC 1 cut(s) 68
SetI ASST 8 cut(s) 162, 193, 226, 315, 338, 416, 431, 443
SfuI TTCGAA 1 cut(s) 114
SmlI CTYRAG 2 cut(s) 314, 366
SmoI CTYRAG 2 cut(s) 314, 366
Sse9I AATT 6 cut(s) 99, 184, 217, 270, 360, 434
SsiI CCGC 1 cut(s) 22
SspI AATATT 1 cut(s) 473
SspMI CTAG 3 cut(s) 35, 192, 408
TaaI ACNGT 3 cut(s) 255, 305, 331
TaqI TCGA 2 cut(s) 114, 250
TasI AATT 6 cut(s) 99, 184, 217, 270, 360, 434
TatI WGTACW 1 cut(s) 136
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 3 cut(s) 201, 315, 475
Tru9I TTAA 3 cut(s) 201, 315, 475
TscAI CASTG 3 cut(s) 260, 334, 471
TseI GCWGC 4 cut(s) 347, 411, 414, 441
TspDTI ATGAA 1 cut(s) 440
TspRI CASTG 3 cut(s) 260, 334, 471
Vha464I CTTAAG 1 cut(s) 314
XapI RAATTY 4 cut(s) 184, 217, 360, 434
XspI CTAG 3 cut(s) 35, 192, 408
ZrmI AGTACT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.