RchiOBHm_Chr2g0132891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
49459609 .. 49459868
260 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50410

Sequence Viewer

Length: 132 bp
ATGGATGAAAAGTCGATTTTCCCCGTGCGTGCTGTTTCTTGCTTCGACACCTGGACTGTTGCTTCGTGCGTGTTGTTTCTTCCTCTGACACCTGGGGTGCTGGTCACACATTTGAGAGGGAGATTTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

4.84

Weight (kDa)

6.53

Isoelectric Point (pI)

29.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 128
AjnI CCWGG 2 cut(s) 50, 91
ArsI GACNNNNNNTTYG 2 cut(s) 46, 78
BciT130I CCWGG 2 cut(s) 52, 93
Bme1390I CCNGG 2 cut(s) 52, 93
BmrFI CCNGG 2 cut(s) 52, 93
BsaJI CCNNGG 1 cut(s) 92
BseBI CCWGG 2 cut(s) 52, 93
BseDI CCNNGG 1 cut(s) 92
BseGI GGATG 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 92
Bst2UI CCWGG 2 cut(s) 52, 93
Bst4CI ACNGT 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 30
BstF5I GGATG 1 cut(s) 10
BstNI CCWGG 2 cut(s) 52, 93
BstSCI CCNGG 2 cut(s) 50, 91
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 30
EcoRII CCWGG 2 cut(s) 50, 91
FokI GGATG 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 87
HpyCH4III ACNGT 1 cut(s) 58
LpnPI CCDG 5 cut(s) 37, 64, 78, 86, 105
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 1 cut(s) 71
MnlI CCTC 2 cut(s) 93, 110
MspR9I CCNGG 2 cut(s) 52, 93
MvaI CCWGG 2 cut(s) 52, 93
NmuCI GTSAC 1 cut(s) 103
Psp6I CCWGG 2 cut(s) 50, 91
PspGI CCWGG 2 cut(s) 50, 91
ScrFI CCNGG 2 cut(s) 52, 93
SetI ASST 2 cut(s) 53, 94
StyD4I CCNGG 2 cut(s) 50, 91
TaaI ACNGT 1 cut(s) 58
TaqI TCGA 2 cut(s) 14, 45
TseFI GTSAC 1 cut(s) 103
Tsp45I GTSAC 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.