Prupe.1G065400_v2.0.a1

EG45-like domain containing protein 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0001334
Physical Location & Seq
Forward (+)
4689214 .. 4689414
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G065400.1

Sequence Viewer

Length: 201 bp
ATGGGGGATAATGGGGCAGCATGTGGAAGATTATACACCGTCAGATGTATTGGGGGTACCAATCGGATGGCAAAACCCTGCACTCAAGTTTCGGTTGTGATTGTCAAGATTGTTGAGTATTGTCCATCAGGATGTCGTGGAACCATTAATCTTTCTCGAGAGGGATTTGTAGTTATTGCCAATCCTGACCAAATGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DPBB_1

Protein Analysis

67

Amino Acids

7.07

Weight (kDa)

8.75

Isoelectric Point (pI)

12.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 56
AccB1I GGYRCC 1 cut(s) 56
AfaI GTAC 1 cut(s) 58
Ama87I CYCGRG 1 cut(s) 156
ApeKI GCWGC 1 cut(s) 17
AseI ATTAAT 1 cut(s) 147
Asp718I GGTACC 1 cut(s) 56
AvaI CYCGRG 1 cut(s) 156
BanI GGYRCC 1 cut(s) 56
BbvI GCAGC 1 cut(s) 29
BccI CCATC 2 cut(s) 61, 133
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
BmeT110I CYCGRG 1 cut(s) 156
BmiI GGNNCC 2 cut(s) 58, 142
BpuEI CTTGAG 1 cut(s) 69
BseGI GGATG 2 cut(s) 72, 137
BseXI GCAGC 1 cut(s) 29
BsgI GTGCAG 1 cut(s) 64
BshNI GGYRCC 1 cut(s) 56
BsiHKCI CYCGRG 1 cut(s) 156
BsoBI CYCGRG 1 cut(s) 156
BspLI GGNNCC 2 cut(s) 58, 142
BspT107I GGYRCC 1 cut(s) 56
Bst4CI ACNGT 1 cut(s) 40
BstF5I GGATG 2 cut(s) 72, 137
BstNSI RCATGY 1 cut(s) 24
BstV1I GCAGC 1 cut(s) 29
BstXI CCANNNNNNTGG 1 cut(s) 67
BtsCI GGATG 2 cut(s) 72, 137
Csp6I GTAC 1 cut(s) 57
CviAII CATG 1 cut(s) 21
CviQI GTAC 1 cut(s) 57
Eco88I CYCGRG 1 cut(s) 156
FaeI CATG 1 cut(s) 24
FaiI YATR 2 cut(s) 22, 34
FatI CATG 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 18
FokI GGATG 2 cut(s) 79, 144
Fsp4HI GCNGC 1 cut(s) 18
GluI GCNGC 1 cut(s) 18
Hin1II CATG 1 cut(s) 24
Hpy188I TCNGA 2 cut(s) 44, 66
Hpy188III TCNNGA 5 cut(s) 106, 129, 156, 158, 185
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 81
Hsp92II CATG 1 cut(s) 24
KpnI GGTACC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 91, 114
Lsp1109I GCAGC 1 cut(s) 29
MboII GAAGA 1 cut(s) 39
MnlI CCTC 1 cut(s) 154
MseI TTAA 2 cut(s) 147, 199
MslI CAYNNNNRTG 1 cut(s) 130
NlaIII CATG 1 cut(s) 24
NlaIV GGNNCC 2 cut(s) 58, 142
NspI RCATGY 1 cut(s) 24
PaeR7I CTCGAG 1 cut(s) 156
PkrI GCNGC 1 cut(s) 19
PshBI ATTAAT 1 cut(s) 147
PspN4I GGNNCC 2 cut(s) 58, 142
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
RseI CAYNNNNRTG 1 cut(s) 130
SaqAI TTAA 2 cut(s) 147, 199
SatI GCNGC 1 cut(s) 18
Sfr274I CTCGAG 1 cut(s) 156
SgeI CNNG 9 cut(s) 33, 90, 98, 118, 141, 149, 168, 170, 197
SlaI CTCGAG 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 130
SmlI CTYRAG 2 cut(s) 84, 156
SmoI CTYRAG 2 cut(s) 84, 156
TaaI ACNGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 157
Tru1I TTAA 2 cut(s) 147, 199
Tru9I TTAA 2 cut(s) 147, 199
TseI GCWGC 1 cut(s) 17
VspI ATTAAT 1 cut(s) 147
XceI RCATGY 1 cut(s) 24
XhoI CTCGAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.