Prupe.4G114400_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
6108817 .. 6109623
807 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G114400.1

Sequence Viewer

Length: 204 bp
ATGGCCTCTGTTCATCGTTGTCACCCTTGTGGTATGCTTGATGGGTACTTGAAGTCTTCAAGGCTAAACCCACCTTGGGAATATCACTTACAGCCAAGTTCAGTCAGCTTTCAATATAGAGGGAGGCCAAGAAAGAGCAACTGGGGCATTGAAAAAACTTGGAGAGGTGAATTGGTGGAAGGGAGGGAGAATCATTTGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.88

Weight (kDa)

9.51

Isoelectric Point (pI)

29.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 47
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 5 cut(s) 52, 60, 113, 152, 199
AleI CACNNNNGTG 1 cut(s) 27
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AoxI GGCC 2 cut(s) 3, 125
AsuHPI GGTGA 2 cut(s) 14, 179
BbsI GAAGAC 1 cut(s) 48
BccI CCATC 1 cut(s) 35
BmrI ACTGGG 1 cut(s) 151
BmuI ACTGGG 1 cut(s) 151
BpiI GAAGAC 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 74
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 146
BseDI CCNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 76
BseNI ACTGG 1 cut(s) 146
BshFI GGCC 2 cut(s) 5, 127
BslI CCNNNNNNNGG 1 cut(s) 76
BsnI GGCC 2 cut(s) 5, 127
BspANI GGCC 2 cut(s) 5, 127
BsrI ACTGG 1 cut(s) 146
BssECI CCNNGG 1 cut(s) 74
BssT1I CCWWGG 1 cut(s) 74
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstV2I GAAGAC 1 cut(s) 48
BsuRI GGCC 2 cut(s) 5, 127
Csp6I GTAC 1 cut(s) 46
CviJI RGCY 5 cut(s) 5, 64, 94, 108, 127
CviKI_1 RGCY 5 cut(s) 5, 64, 94, 108, 127
CviQI GTAC 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 74
ErhI CCWWGG 1 cut(s) 74
FaiI YATR 2 cut(s) 35, 117
HaeIII GGCC 2 cut(s) 5, 127
HinfI GANTC 1 cut(s) 190
HphI GGTGA 2 cut(s) 14, 179
HpyAV CCTTC 1 cut(s) 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
LpnPI CCDG 1 cut(s) 127
MaeIII GTNAC 1 cut(s) 20
MboII GAAGA 1 cut(s) 48
MluCI AATT 2 cut(s) 170, 199
MnlI CCTC 5 cut(s) 16, 113, 117, 158, 177
MslI CAYNNNNRTG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 20
OliI CACNNNNGTG 1 cut(s) 27
PfeI GAWTC 1 cut(s) 190
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
RseI CAYNNNNRTG 1 cut(s) 27
SetI ASST 3 cut(s) 76, 110, 169
SgeI CNNG 9 cut(s) 39, 50, 61, 72, 87, 108, 141, 154, 171
SmiMI CAYNNNNRTG 1 cut(s) 27
Sse9I AATT 2 cut(s) 170, 199
StyI CCWWGG 1 cut(s) 74
TasI AATT 2 cut(s) 170, 199
TfiI GAWTC 1 cut(s) 190
TseFI GTSAC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.