Prupe.8G198000_v2.0.a1

Ethylene-responsive transcription factor-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0002266
Physical Location & Seq
Forward (+)
18879926 .. 18881688
1763 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G198000.1

Sequence Viewer

Length: 168 bp
ATGGTGAGCATAAGAAGAAGCAAACGCTTGAGACTACGTGCTGAGAGTTCTGTTCTAGCTCCAGTGCCAAGGTTTTGTGACAAGGGAACTGCTCAAAATTCTACACAAACAAAACCAGATACTGTGCAGTCAATTCCTTCAAATGATGTGAACCTGCCGGAGGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AP2

Protein Analysis

56

Amino Acids

6.05

Weight (kDa)

10.26

Isoelectric Point (pI)

66.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 1 cut(s) 141
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 25
AlwNI CAGNNNCTG 1 cut(s) 122
ApoI RAATTY 1 cut(s) 97
AsuHPI GGTGA 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 25
BfaI CTAG 1 cut(s) 56
BfuAI ACCTGC 1 cut(s) 162
BpmI CTGGAG 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 49
BsaAI YACGTR 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 68
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 33
BseNI ACTGG 1 cut(s) 62
BsgI GTGCAG 1 cut(s) 146
BsiSI CCGG 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 34
BspMI ACCTGC 1 cut(s) 162
BsrI ACTGG 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 68
BssT1I CCWWGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 124
BstBAI YACGTR 1 cut(s) 38
BstDEI CTNAG 1 cut(s) 42
BstENI CCTNNNNNAGG 1 cut(s) 158
BstMAI GTCTC 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 69
BveI ACCTGC 1 cut(s) 162
CaiI CAGNNNCTG 1 cut(s) 122
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
DdeI CTNAG 1 cut(s) 42
Eco130I CCWWGG 1 cut(s) 68
EcoNI CCTNNNNNAGG 1 cut(s) 158
EcoT14I CCWWGG 1 cut(s) 68
ErhI CCWWGG 1 cut(s) 68
FaiI YATR 1 cut(s) 11
FspBI CTAG 1 cut(s) 56
GsuI CTGGAG 1 cut(s) 45
HapII CCGG 1 cut(s) 158
HpaII CCGG 1 cut(s) 158
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 151
Hpy8I GTNNAC 1 cut(s) 151
HpyAV CCTTC 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 124
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 37
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 75, 129
MaeI CTAG 1 cut(s) 56
MaeII ACGT 1 cut(s) 37
MaeIII GTNAC 1 cut(s) 77
MboII GAAGA 1 cut(s) 27
MluCI AATT 2 cut(s) 97, 132
MnlI CCTC 1 cut(s) 154
MspI CCGG 1 cut(s) 158
NmuCI GTSAC 1 cut(s) 77
Ppu21I YACGTR 1 cut(s) 38
PstNI CAGNNNCTG 1 cut(s) 122
SetI ASST 4 cut(s) 40, 61, 74, 156
SgeI CNNG 7 cut(s) 40, 50, 68, 74, 81, 94, 128
SmlI CTYRAG 1 cut(s) 28
SmoI CTYRAG 1 cut(s) 28
Sse9I AATT 2 cut(s) 97, 132
SspMI CTAG 1 cut(s) 56
StyI CCWWGG 1 cut(s) 68
TaaI ACNGT 1 cut(s) 124
TaiI ACGT 1 cut(s) 40
TasI AATT 2 cut(s) 97, 132
TscAI CASTG 1 cut(s) 69
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
TspRI CASTG 1 cut(s) 69
XagI CCTNNNNNAGG 1 cut(s) 158
XapI RAATTY 1 cut(s) 97
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.