Rh6AG272800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
46677766 .. 46678032
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG272800.1

Sequence Viewer

Length: 267 bp
ATGAGGCAACAGGTCCTGGAATACTCTAGCATGAAGAGGGAGTATGAGCCCAAGCTTGATGGTTTGTTAAATGATGTTAGTCAGCAGAGGCAGAAGGCTGAAATGTGGGAGAGTAAGTGCAAGGAGCAGGAGGCCTTGCATCAGGTTAAGGCTACTCGTCTGGAGGAGTTTTCTTGTCACCTGGAAGAGGTCTTGAAGCAGCTTGGGGAGGCCAATGCTGACCTTTCTGAGGTCACTCAGGGCCTTCATGTGGCTAGGGAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.27

Weight (kDa)

5.18

Isoelectric Point (pI)

45.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 3 cut(s) 187, 229, 250
AgsI TTSAA 1 cut(s) 196
AjnI CCWGG 2 cut(s) 15, 180
AluBI AGCT 2 cut(s) 55, 202
AluI AGCT 2 cut(s) 55, 202
AlwNI CAGNNNCTG 1 cut(s) 16
AoxI GGCC 3 cut(s) 132, 210, 241
ApeKI GCWGC 1 cut(s) 199
AspS9I GGNCC 2 cut(s) 13, 241
AsuHPI GGTGA 1 cut(s) 170
AvaII GGWCC 1 cut(s) 13
BanII GRGCYC 1 cut(s) 51
BbvI GCAGC 1 cut(s) 211
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 17, 182
BfaI CTAG 2 cut(s) 27, 255
BisI GCNGC 1 cut(s) 200
BlsI GCNGC 1 cut(s) 201
Bme1390I CCNGG 2 cut(s) 17, 182
Bme18I GGWCC 1 cut(s) 13
BmgT120I GGNCC 2 cut(s) 13, 241
BmrFI CCNGG 2 cut(s) 17, 182
BmsI GCATC 1 cut(s) 148
BpmI CTGGAG 1 cut(s) 182
BsaXI ACNNNNNCTCC 2 cut(s) 101, 131
Bsc4I CCNNNNNNNGG 3 cut(s) 187, 229, 250
BseBI CCWGG 2 cut(s) 17, 182
BseLI CCNNNNNNNGG 3 cut(s) 187, 229, 250
BseMII CTCAG 2 cut(s) 219, 251
BseRI GAGGAG 1 cut(s) 179
BseXI GCAGC 1 cut(s) 211
BshFI GGCC 3 cut(s) 134, 212, 243
BslI CCNNNNNNNGG 3 cut(s) 187, 229, 250
BsnI GGCC 3 cut(s) 134, 212, 243
Bsp1286I GDGCHC 1 cut(s) 51
BspANI GGCC 3 cut(s) 134, 212, 243
BspCNI CTCAG 2 cut(s) 220, 250
Bst2UI CCWGG 2 cut(s) 17, 182
Bst6I CTCTTC 2 cut(s) 29, 180
BstDEI CTNAG 2 cut(s) 228, 237
BstENI CCTNNNNNAGG 2 cut(s) 185, 227
BstNI CCWGG 2 cut(s) 17, 182
BstSCI CCNGG 2 cut(s) 15, 180
BstV1I GCAGC 1 cut(s) 211
BsuRI GGCC 3 cut(s) 134, 212, 243
CaiI CAGNNNCTG 1 cut(s) 16
Cfr13I GGNCC 2 cut(s) 13, 241
CviAII CATG 2 cut(s) 31, 248
CviJI RGCY 9 cut(s) 49, 55, 98, 134, 152, 202, 212, 243, 254
CviKI_1 RGCY 9 cut(s) 49, 55, 98, 134, 152, 202, 212, 243, 254
DdeI CTNAG 2 cut(s) 228, 237
Eam1104I CTCTTC 2 cut(s) 29, 180
EarI CTCTTC 2 cut(s) 29, 180
Eco147I AGGCCT 1 cut(s) 134
Eco24I GRGCYC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 13
EcoNI CCTNNNNNAGG 2 cut(s) 185, 227
EcoO109I RGGNCCY 2 cut(s) 13, 241
EcoRII CCWGG 2 cut(s) 15, 180
EcoT38I GRGCYC 1 cut(s) 51
FaeI CATG 2 cut(s) 34, 251
FaiI YATR 3 cut(s) 32, 45, 249
FatI CATG 2 cut(s) 30, 247
Fnu4HI GCNGC 1 cut(s) 200
FriOI GRGCYC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 200
FspBI CTAG 2 cut(s) 27, 255
GluI GCNGC 1 cut(s) 200
GsuI CTGGAG 1 cut(s) 182
HaeIII GGCC 3 cut(s) 134, 212, 243
Hin1II CATG 2 cut(s) 34, 251
HindIII AAGCTT 1 cut(s) 53
HphI GGTGA 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 229
Hpy188III TCNNGA 2 cut(s) 161, 193
HpyAV CCTTC 2 cut(s) 88, 254
HpyCH4V TGCA 2 cut(s) 120, 139
HpyF3I CTNAG 2 cut(s) 228, 237
Hsp92II CATG 2 cut(s) 34, 251
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 8 cut(s) 2, 29, 113, 128, 146, 167, 194, 224
Lsp1109I GCAGC 1 cut(s) 211
LweI GCATC 1 cut(s) 148
MaeI CTAG 2 cut(s) 27, 255
MaeIII GTNAC 2 cut(s) 176, 232
MboII GAAGA 2 cut(s) 46, 197
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 1 cut(s) 262
MnlI CCTC 7 cut(s) 30, 81, 124, 157, 181, 202, 223
MseI TTAA 2 cut(s) 68, 147
MspR9I CCNGG 2 cut(s) 17, 182
MvaI CCWGG 2 cut(s) 17, 182
NlaIII CATG 2 cut(s) 34, 251
NmuCI GTSAC 2 cut(s) 176, 232
PceI AGGCCT 1 cut(s) 134
PfoI TCCNGGA 1 cut(s) 15
PkrI GCNGC 1 cut(s) 201
PpuMI RGGWCCY 1 cut(s) 13
Psp5II RGGWCCY 1 cut(s) 13
Psp6I CCWGG 2 cut(s) 15, 180
PspGI CCWGG 2 cut(s) 15, 180
PspPI GGNCC 2 cut(s) 13, 241
PspPPI RGGWCCY 1 cut(s) 13
PstNI CAGNNNCTG 1 cut(s) 16
SaqAI TTAA 2 cut(s) 68, 147
SatI GCNGC 1 cut(s) 200
Sau96I GGNCC 2 cut(s) 13, 241
ScrFI CCNGG 2 cut(s) 17, 182
SduI GDGCHC 1 cut(s) 51
SetI ASST 8 cut(s) 15, 57, 147, 183, 192, 204, 225, 234
SfaNI GCATC 1 cut(s) 148
SinI GGWCC 1 cut(s) 13
Sse9I AATT 1 cut(s) 262
SseBI AGGCCT 1 cut(s) 134
SspMI CTAG 2 cut(s) 27, 255
StuI AGGCCT 1 cut(s) 134
StyD4I CCNGG 2 cut(s) 15, 180
TasI AATT 1 cut(s) 262
Tru1I TTAA 2 cut(s) 68, 147
Tru9I TTAA 2 cut(s) 68, 147
TseFI GTSAC 2 cut(s) 176, 232
TseI GCWGC 1 cut(s) 199
Tsp45I GTSAC 2 cut(s) 176, 232
TspDTI ATGAA 2 cut(s) 47, 236
VpaK11BI GGWCC 1 cut(s) 13
XagI CCTNNNNNAGG 2 cut(s) 185, 227
XspI CTAG 2 cut(s) 27, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.