Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6C

Orthogroup ID

OG0002266

Physical Location & Seq

Genomic Coordinates Forward (+)

45072820 .. 45073086

Gene Structure 267 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6CG274600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGAGGCAACAGGTCCTGGAATACTCTAGCATGAAGAGGGAGTATGAGCCCAAGCTTGATGGTTTGTTAAATGATGTTAGTCAGCAGAGGCAGAAGGCTGAAATGTGGGAGAGTAAGTGCAAGGAGCAGGAGGCCTTGCATCAGGTTAAGGCTACTCGTCTGGAGGAGTTTTCTTGTCACCTGGAAGAGGTCTTGAAGCAGCTTGGGGAGGCCAATGCTGACCTTTCTGAGGTCACTCAGGGCCTTCATGTGGCTAGGGAAAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

88

Amino Acids

10.27

Weight (kDa)

5.18

Isoelectric Point (pI)

45.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002266)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g18500 FvH4_2g18510 FvH4_2g18510 FvH4_2g18510 FvH4_2g18510 FvH4_2g18510
malus_domestica	MD05G1170700.v1.1
prunus_persica	Prupe.8G198000_v2.0.a1 Prupe.8G198100_v2.0.a1 Prupe.8G198200_v2.0.a1 Prupe.8G198200_v2.0.a1 Prupe.8G198300_v2.0.a1 Prupe.8G198400_v2.0.a1
pyrus_communis	pycom05g15790
rosa_chinensis	RchiOBHm_Chr6g0284021 RchiOBHm_Chr6g0284061
rosa_laevigata	RLG00000012773 RLG00000012776
rosa_multiflora	Rmu_sc0003102.1_g000003 Rmu_sc0015649.1_g000013 Rmu_ssc0000442.1_g000043
rosa_roxburghii	Rroxscaffold_7G00183920 Rroxscaffold_7G00184970
rosa_rugosa	Rorug06G0159400 Rorug06G0159500 Rorug06G0159600 Rorug06G0160100
rosa_samantha	Rh6AG272700 Rh6AG272800 Rh6AG272900 Rh6AG273200 Rh6BG273300 Rh6BG273700 Rh6BG273800 Rh6CG274500 Rh6CG274600 Rh6CG274700 Rh6CG275300 Rh6CG283300 Rh6DG267700 Rh6DG268200
rosa_wichuraiana	Rw6G023480 Rw6G023510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	3 cut(s)	187, 229, 250
AgsI	TTSAA	1 cut(s)	196
AjnI	CCWGG	2 cut(s)	15, 180
AluBI	AGCT	2 cut(s)	55, 202
AluI	AGCT	2 cut(s)	55, 202
AlwNI	CAGNNNCTG	1 cut(s)	16
AoxI	GGCC	3 cut(s)	132, 210, 241
ApeKI	GCWGC	1 cut(s)	199
AspS9I	GGNCC	2 cut(s)	13, 241
AsuHPI	GGTGA	1 cut(s)	170
AvaII	GGWCC	1 cut(s)	13
BanII	GRGCYC	1 cut(s)	51
BbvI	GCAGC	1 cut(s)	211
BccI	CCATC	1 cut(s)	53
BciT130I	CCWGG	2 cut(s)	17, 182
BfaI	CTAG	2 cut(s)	27, 255
BisI	GCNGC	1 cut(s)	200
BlsI	GCNGC	1 cut(s)	201
Bme1390I	CCNGG	2 cut(s)	17, 182
Bme18I	GGWCC	1 cut(s)	13
BmgT120I	GGNCC	2 cut(s)	13, 241
BmrFI	CCNGG	2 cut(s)	17, 182
BmsI	GCATC	1 cut(s)	148
BpmI	CTGGAG	1 cut(s)	182
BsaXI	ACNNNNNCTCC	2 cut(s)	101, 131
Bsc4I	CCNNNNNNNGG	3 cut(s)	187, 229, 250
BseBI	CCWGG	2 cut(s)	17, 182
BseLI	CCNNNNNNNGG	3 cut(s)	187, 229, 250
BseMII	CTCAG	2 cut(s)	219, 251
BseRI	GAGGAG	1 cut(s)	179
BseXI	GCAGC	1 cut(s)	211
BshFI	GGCC	3 cut(s)	134, 212, 243
BslI	CCNNNNNNNGG	3 cut(s)	187, 229, 250
BsnI	GGCC	3 cut(s)	134, 212, 243
Bsp1286I	GDGCHC	1 cut(s)	51
BspANI	GGCC	3 cut(s)	134, 212, 243
BspCNI	CTCAG	2 cut(s)	220, 250
Bst2UI	CCWGG	2 cut(s)	17, 182
Bst6I	CTCTTC	2 cut(s)	29, 180
BstDEI	CTNAG	2 cut(s)	228, 237
BstENI	CCTNNNNNAGG	2 cut(s)	185, 227
BstNI	CCWGG	2 cut(s)	17, 182
BstSCI	CCNGG	2 cut(s)	15, 180
BstV1I	GCAGC	1 cut(s)	211
BsuRI	GGCC	3 cut(s)	134, 212, 243
CaiI	CAGNNNCTG	1 cut(s)	16
Cfr13I	GGNCC	2 cut(s)	13, 241
CviAII	CATG	2 cut(s)	31, 248
CviJI	RGCY	9 cut(s)	49, 55, 98, 134, 152, 202, 212, 243, 254
CviKI_1	RGCY	9 cut(s)	49, 55, 98, 134, 152, 202, 212, 243, 254
DdeI	CTNAG	2 cut(s)	228, 237
Eam1104I	CTCTTC	2 cut(s)	29, 180
EarI	CTCTTC	2 cut(s)	29, 180
Eco147I	AGGCCT	1 cut(s)	134
Eco24I	GRGCYC	1 cut(s)	51
Eco47I	GGWCC	1 cut(s)	13
EcoNI	CCTNNNNNAGG	2 cut(s)	185, 227
EcoO109I	RGGNCCY	2 cut(s)	13, 241
EcoRII	CCWGG	2 cut(s)	15, 180
EcoT38I	GRGCYC	1 cut(s)	51
FaeI	CATG	2 cut(s)	34, 251
FaiI	YATR	3 cut(s)	32, 45, 249
FatI	CATG	2 cut(s)	30, 247
Fnu4HI	GCNGC	1 cut(s)	200
FriOI	GRGCYC	1 cut(s)	51
Fsp4HI	GCNGC	1 cut(s)	200
FspBI	CTAG	2 cut(s)	27, 255
GluI	GCNGC	1 cut(s)	200
GsuI	CTGGAG	1 cut(s)	182
HaeIII	GGCC	3 cut(s)	134, 212, 243
Hin1II	CATG	2 cut(s)	34, 251
HindIII	AAGCTT	1 cut(s)	53
HphI	GGTGA	1 cut(s)	170
Hpy188I	TCNGA	1 cut(s)	229
Hpy188III	TCNNGA	2 cut(s)	161, 193
HpyAV	CCTTC	2 cut(s)	88, 254
HpyCH4V	TGCA	2 cut(s)	120, 139
HpyF3I	CTNAG	2 cut(s)	228, 237
Hsp92II	CATG	2 cut(s)	34, 251
LmnI	GCTCC	1 cut(s)	124
LpnPI	CCDG	8 cut(s)	2, 29, 113, 128, 146, 167, 194, 224
Lsp1109I	GCAGC	1 cut(s)	211
LweI	GCATC	1 cut(s)	148
MaeI	CTAG	2 cut(s)	27, 255
MaeIII	GTNAC	2 cut(s)	176, 232
MboII	GAAGA	2 cut(s)	46, 197
MhlI	GDGCHC	1 cut(s)	51
MluCI	AATT	1 cut(s)	262
MnlI	CCTC	7 cut(s)	30, 81, 124, 157, 181, 202, 223
MseI	TTAA	2 cut(s)	68, 147
MspR9I	CCNGG	2 cut(s)	17, 182
MvaI	CCWGG	2 cut(s)	17, 182
NlaIII	CATG	2 cut(s)	34, 251
NmuCI	GTSAC	2 cut(s)	176, 232
PceI	AGGCCT	1 cut(s)	134
PfoI	TCCNGGA	1 cut(s)	15
PkrI	GCNGC	1 cut(s)	201
PpuMI	RGGWCCY	1 cut(s)	13
Psp5II	RGGWCCY	1 cut(s)	13
Psp6I	CCWGG	2 cut(s)	15, 180
PspGI	CCWGG	2 cut(s)	15, 180
PspPI	GGNCC	2 cut(s)	13, 241
PspPPI	RGGWCCY	1 cut(s)	13
PstNI	CAGNNNCTG	1 cut(s)	16
SaqAI	TTAA	2 cut(s)	68, 147
SatI	GCNGC	1 cut(s)	200
Sau96I	GGNCC	2 cut(s)	13, 241
ScrFI	CCNGG	2 cut(s)	17, 182
SduI	GDGCHC	1 cut(s)	51
SetI	ASST	8 cut(s)	15, 57, 147, 183, 192, 204, 225, 234
SfaNI	GCATC	1 cut(s)	148
SinI	GGWCC	1 cut(s)	13
Sse9I	AATT	1 cut(s)	262
SseBI	AGGCCT	1 cut(s)	134
SspMI	CTAG	2 cut(s)	27, 255
StuI	AGGCCT	1 cut(s)	134
StyD4I	CCNGG	2 cut(s)	15, 180
TasI	AATT	1 cut(s)	262
Tru1I	TTAA	2 cut(s)	68, 147
Tru9I	TTAA	2 cut(s)	68, 147
TseFI	GTSAC	2 cut(s)	176, 232
TseI	GCWGC	1 cut(s)	199
Tsp45I	GTSAC	2 cut(s)	176, 232
TspDTI	ATGAA	2 cut(s)	47, 236
VpaK11BI	GGWCC	1 cut(s)	13
XagI	CCTNNNNNAGG	2 cut(s)	185, 227
XspI	CTAG	2 cut(s)	27, 255

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.