Rorug06G0159600

Domain of unknown function (DUF3444)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0002266
Physical Location & Seq
Forward (+)
22754387 .. 22754617
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0159600.1

Sequence Viewer

Length: 231 bp
ATGCTGGGATCTACTAATGTTTTAGTAGCAGAAGCCATAGCTTTACATGAAGCATTGCATACTGCTTATCTTCAAGGTTTCAACCATATAATCGTGGAGGCGGATTCTAAGCATGTCATTGACTGTATTCTTTGTTCTGTGACTGTTCCTTGGTATCTCAAGACTTTGATTCAAGATATTAGAGATATGGCAAACAAAGTTCAGCATATCATCTTCAGACATTTATCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
DUF3444 DnaJ

Protein Analysis

76

Amino Acids

8.58

Weight (kDa)

6.25

Isoelectric Point (pI)

34.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 3 - 75 2.3e-10 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 101
AclWI GGATC 1 cut(s) 16
AcuI CTGAAG 1 cut(s) 199
AgsI TTSAA 3 cut(s) 74, 82, 173
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AlwI GGATC 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 149
Bse3DI GCAATG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 149
BseMI GCAATG 1 cut(s) 53
BseYI CCCAGC 1 cut(s) 4
Bsp143I GATC 1 cut(s) 8
BspACI CCGC 1 cut(s) 101
BspPI GGATC 1 cut(s) 16
BsrDI GCAATG 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 1 cut(s) 8
BssT1I CCWWGG 1 cut(s) 149
Bst4CI ACNGT 2 cut(s) 125, 145
BstDEI CTNAG 1 cut(s) 108
BstKTI GATC 1 cut(s) 11
BstMBI GATC 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 116
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
CviAII CATG 2 cut(s) 47, 113
CviJI RGCY 2 cut(s) 35, 41
CviKI_1 RGCY 2 cut(s) 35, 41
DdeI CTNAG 1 cut(s) 108
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
EciI GGCGGA 1 cut(s) 116
Eco130I CCWWGG 1 cut(s) 149
Eco57I CTGAAG 1 cut(s) 199
EcoT14I CCWWGG 1 cut(s) 149
ErhI CCWWGG 1 cut(s) 149
FaeI CATG 2 cut(s) 50, 116
FaiI YATR 8 cut(s) 38, 48, 60, 87, 89, 114, 188, 207
FatI CATG 2 cut(s) 46, 112
FspEI CC 9 cut(s) 49, 60, 80, 83, 86, 98, 136, 162, 173
GsaI CCCAGC 1 cut(s) 8
Hin1II CATG 2 cut(s) 50, 116
HinfI GANTC 2 cut(s) 104, 169
Hpy188I TCNGA 1 cut(s) 218
Hpy188III TCNNGA 3 cut(s) 160, 173, 228
HpyCH4III ACNGT 2 cut(s) 125, 145
HpyCH4V TGCA 1 cut(s) 58
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 2 cut(s) 50, 116
Kzo9I GATC 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 2 cut(s) 62, 205
MflI RGATCY 1 cut(s) 8
MnlI CCTC 1 cut(s) 91
NdeII GATC 1 cut(s) 8
NlaIII CATG 2 cut(s) 50, 116
NmuCI GTSAC 1 cut(s) 139
NspI RCATGY 1 cut(s) 116
PfeI GAWTC 2 cut(s) 104, 169
PspFI CCCAGC 1 cut(s) 4
PsrI GAACNNNNNNTAC 2 cut(s) 118, 150
PsuI RGATCY 1 cut(s) 8
Sau3AI GATC 1 cut(s) 8
SetI ASST 2 cut(s) 43, 79
SgeI CNNG 8 cut(s) 17, 59, 86, 106, 125, 162, 172, 185
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SsiI CCGC 1 cut(s) 101
StyI CCWWGG 1 cut(s) 149
TaaI ACNGT 2 cut(s) 125, 145
TfiI GAWTC 2 cut(s) 104, 169
TseFI GTSAC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 139
TspDTI ATGAA 1 cut(s) 63
XceI RCATGY 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.