pycom05g15790

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
19292779 .. 19293804
1026 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g15790.3

Sequence Viewer

Length: 606 bp
ATGGTGAGCTTAAGAAGACACACACACTATAGACTATGTGCTGGGAGAACTCCACTTCCTAAGTTCTCTGACATCAGAACTGCTTCTCAATATCCCAACCACGAAAAACCAAAAAGTTCGCATCCCACATGTTCAAATAATGTAATTAATCGACCAGAGGGGAATAGGACTGCTATAGGGGCTTCGGCTAAGAGTTTCACTGATGCGGTGCTGGCTTTGCCTGCTTTTGTAACTGTGGGAAATGAGGCAGGACACTCTCGTATACACAAGCTGCATTTTCAGAAAAATGGGGATTCTCTTTGGGCTGACGTATCTCAAAGCAGCCAAGTTAGTTCCTTGGAGAATCAAGTAAATGATCCGGGGTTTGATGTATCTCTAAGCGGCCAAGTTAAATCCATGGAGAGCCAAGTAAAAGACCCAGGGGATAAAGTTCTAAGCAGCCAAGTTGAATCCTTGCAGAGCCTAGTAAAATACCCGGAAGCTGACGTATCTCTAAGCAGCCAAAATGAATCCTTGCATAGCCAAGTAAAAGACCTTGAAGCTGACGTATCTCCAAGCAGCCAGGTTAAATCCTCGGAGAACCAAGTAAACGACCCAGGGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

202

Amino Acids

21.75

Weight (kDa)

6.44

Isoelectric Point (pI)

43.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 262
AciI CCGC 2 cut(s) 206, 381
AclWI GGATC 1 cut(s) 350
AcoI YGGCCR 1 cut(s) 382
AflII CTTAAG 1 cut(s) 10
AflIII ACRYGT 1 cut(s) 128
AgsI TTSAA 3 cut(s) 135, 449, 539
AjnI CCWGG 3 cut(s) 418, 561, 595
AloI GAACNNNNNNTCC 2 cut(s) 40, 72
AluBI AGCT 4 cut(s) 9, 271, 482, 542
AluI AGCT 4 cut(s) 9, 271, 482, 542
AlwI GGATC 1 cut(s) 350
AoxI GGCC 1 cut(s) 382
ApeKI GCWGC 5 cut(s) 271, 321, 438, 498, 558
AseI ATTAAT 1 cut(s) 147
Asp700I GAANNNNTTC 1 cut(s) 82
AsuC2I CCSGG 2 cut(s) 360, 476
AsuHPI GGTGA 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 22
BbvI GCAGC 5 cut(s) 258, 333, 450, 510, 570
BciT130I CCWGG 3 cut(s) 420, 563, 597
BcnI CCSGG 2 cut(s) 360, 476
BfaI CTAG 1 cut(s) 464
BfmI CTRYAG 2 cut(s) 28, 174
BfrI CTTAAG 1 cut(s) 10
BisI GCNGC 6 cut(s) 272, 322, 382, 439, 499, 559
BlsI GCNGC 6 cut(s) 273, 323, 383, 440, 500, 560
Bme1390I CCNGG 5 cut(s) 360, 420, 476, 563, 597
BmrFI CCNGG 5 cut(s) 360, 420, 476, 563, 597
BmsI GCATC 2 cut(s) 130, 193
BpiI GAAGAC 1 cut(s) 22
BpuMI CCSGG 2 cut(s) 360, 476
BsaJI CCNNGG 8 cut(s) 336, 359, 396, 418, 419, 573, 595, 596
BseBI CCWGG 3 cut(s) 420, 563, 597
BseDI CCNNGG 8 cut(s) 336, 359, 396, 418, 419, 573, 595, 596
BseGI GGATG 1 cut(s) 121
BseXI GCAGC 5 cut(s) 258, 333, 450, 510, 570
BseYI CCCAGC 1 cut(s) 41
BshFI GGCC 1 cut(s) 384
BsiSI CCGG 2 cut(s) 359, 476
BsnI GGCC 1 cut(s) 384
Bsp143I GATC 1 cut(s) 355
Bsp19I CCATGG 1 cut(s) 396
BspACI CCGC 2 cut(s) 206, 381
BspANI GGCC 1 cut(s) 384
BspPI GGATC 1 cut(s) 350
BspTI CTTAAG 1 cut(s) 10
BssECI CCNNGG 8 cut(s) 336, 359, 396, 418, 419, 573, 595, 596
BssMI GATC 1 cut(s) 355
BssNAI GTATAC 1 cut(s) 263
BssT1I CCWWGG 2 cut(s) 336, 396
Bst1107I GTATAC 1 cut(s) 263
Bst2UI CCWGG 3 cut(s) 420, 563, 597
Bst4CI ACNGT 1 cut(s) 235
BstAFI CTTAAG 1 cut(s) 10
BstC8I GCNNGC 2 cut(s) 213, 222
BstDEI CTNAG 5 cut(s) 60, 189, 377, 434, 494
BstDSI CCRYGG 1 cut(s) 396
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 358
BstMBI GATC 1 cut(s) 355
BstMWI GCNNNNNNNGC 4 cut(s) 179, 212, 217, 221
BstNI CCWGG 3 cut(s) 420, 563, 597
BstNSI RCATGY 1 cut(s) 132
BstSCI CCNGG 5 cut(s) 358, 418, 474, 561, 595
BstSFI CTRYAG 2 cut(s) 28, 174
BstV1I GCAGC 5 cut(s) 258, 333, 450, 510, 570
BstV2I GAAGAC 1 cut(s) 22
BstZ17I GTATAC 1 cut(s) 263
BsuRI GGCC 1 cut(s) 384
BtgI CCRYGG 1 cut(s) 396
BtsCI GGATG 1 cut(s) 121
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 2 cut(s) 213, 222
CviAII CATG 2 cut(s) 129, 397
DdeI CTNAG 5 cut(s) 60, 189, 377, 434, 494
DpnI GATC 1 cut(s) 357
DpnII GATC 1 cut(s) 355
EaeI YGGCCR 1 cut(s) 382
Eco130I CCWWGG 2 cut(s) 336, 396
EcoRII CCWGG 3 cut(s) 418, 561, 595
EcoT14I CCWWGG 2 cut(s) 336, 396
ErhI CCWWGG 2 cut(s) 336, 396
FaeI CATG 2 cut(s) 132, 400
FaiI YATR 7 cut(s) 30, 37, 130, 176, 263, 398, 519
FatI CATG 2 cut(s) 128, 396
FblI GTMKAC 1 cut(s) 262
Fnu4HI GCNGC 6 cut(s) 272, 322, 382, 439, 499, 559
FokI GGATG 1 cut(s) 108
Fsp4HI GCNGC 6 cut(s) 272, 322, 382, 439, 499, 559
FspBI CTAG 1 cut(s) 464
GluI GCNGC 6 cut(s) 272, 322, 382, 439, 499, 559
GsaI CCCAGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 384
HapII CCGG 2 cut(s) 359, 476
Hin1II CATG 2 cut(s) 132, 400
HinfI GANTC 4 cut(s) 293, 343, 449, 509
HpaII CCGG 2 cut(s) 359, 476
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 2 cut(s) 263, 589
Hpy188I TCNGA 4 cut(s) 70, 77, 282, 577
Hpy8I GTNNAC 2 cut(s) 263, 589
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4IV ACGT 3 cut(s) 309, 486, 546
HpyCH4V TGCA 3 cut(s) 274, 457, 517
HpyF10VI GCNNNNNNNGC 4 cut(s) 179, 212, 217, 221
HpyF3I CTNAG 5 cut(s) 60, 189, 377, 434, 494
HpySE526I ACGT 3 cut(s) 309, 486, 546
Hsp92II CATG 2 cut(s) 132, 400
Kzo9I GATC 1 cut(s) 355
Lsp1109I GCAGC 5 cut(s) 258, 333, 450, 510, 570
LweI GCATC 2 cut(s) 130, 193
MaeI CTAG 1 cut(s) 464
MaeII ACGT 3 cut(s) 309, 486, 546
MaeIII GTNAC 1 cut(s) 229
MalI GATC 1 cut(s) 357
MboI GATC 1 cut(s) 355
MboII GAAGA 1 cut(s) 27
MluCI AATT 1 cut(s) 144
MnlI CCTC 3 cut(s) 151, 238, 583
MroXI GAANNNNTTC 1 cut(s) 82
MseI TTAA 4 cut(s) 11, 147, 390, 567
MspCI CTTAAG 1 cut(s) 10
MspI CCGG 2 cut(s) 359, 476
MspR9I CCNGG 5 cut(s) 360, 420, 476, 563, 597
MvaI CCWGG 3 cut(s) 420, 563, 597
MwoI GCNNNNNNNGC 4 cut(s) 179, 212, 217, 221
NciI CCSGG 2 cut(s) 360, 476
NcoI CCATGG 1 cut(s) 396
NdeII GATC 1 cut(s) 355
NlaIII CATG 2 cut(s) 132, 400
NspI RCATGY 1 cut(s) 132
PasI CCCWGGG 2 cut(s) 419, 596
PciI ACATGT 1 cut(s) 128
PdmI GAANNNNTTC 1 cut(s) 82
PfeI GAWTC 4 cut(s) 293, 343, 449, 509
PkrI GCNGC 6 cut(s) 273, 323, 383, 440, 500, 560
PscI ACATGT 1 cut(s) 128
PshBI ATTAAT 1 cut(s) 147
Psp6I CCWGG 3 cut(s) 418, 561, 595
PspFI CCCAGC 1 cut(s) 41
PspGI CCWGG 3 cut(s) 418, 561, 595
SaqAI TTAA 4 cut(s) 11, 147, 390, 567
SatI GCNGC 6 cut(s) 272, 322, 382, 439, 499, 559
Sau3AI GATC 1 cut(s) 355
ScrFI CCNGG 5 cut(s) 360, 420, 476, 563, 597
SetI ASST 9 cut(s) 11, 273, 312, 484, 489, 537, 544, 549, 567
SfaNI GCATC 2 cut(s) 130, 193
SfcI CTRYAG 2 cut(s) 28, 174
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
Sse9I AATT 1 cut(s) 144
SsiI CCGC 2 cut(s) 206, 381
SspMI CTAG 1 cut(s) 464
StyD4I CCNGG 5 cut(s) 358, 418, 474, 561, 595
StyI CCWWGG 2 cut(s) 336, 396
TaaI ACNGT 1 cut(s) 235
TaiI ACGT 3 cut(s) 312, 489, 549
TaqI TCGA 1 cut(s) 151
TasI AATT 1 cut(s) 144
TauI GCSGC 1 cut(s) 384
TfiI GAWTC 4 cut(s) 293, 343, 449, 509
Tru1I TTAA 4 cut(s) 11, 147, 390, 567
Tru9I TTAA 4 cut(s) 11, 147, 390, 567
TscAI CASTG 1 cut(s) 205
TseI GCWGC 5 cut(s) 271, 321, 438, 498, 558
TspDTI ATGAA 1 cut(s) 522
TspRI CASTG 1 cut(s) 205
Vha464I CTTAAG 1 cut(s) 10
VspI ATTAAT 1 cut(s) 147
XceI RCATGY 1 cut(s) 132
XmiI GTMKAC 1 cut(s) 262
XmnI GAANNNNTTC 1 cut(s) 82
XspI CTAG 1 cut(s) 464
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.