pycom02g26470

Belongs to the EF-1-beta EF-1-delta family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
OG0003320
Physical Location & Seq
Reverse (-)
24252096 .. 24252609
514 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g26470.1

Sequence Viewer

Length: 210 bp
ATGAAAAAGCTTGAGGAGGCTGTAAGAAGTGTCCACTTGGAAGGCTTGCATTGGGGAGCATCCAAACTTGTAGCTGTTGGGTACGGGATTAAGAAGTTGCAAATAATGATGACAATTGTTGATGACCTGGTCTCTGTTGACACTCTCATTGAGGAACATCTTACTGTCGAACCAATTAATGAGATTGGAGCTTGCAGAGATGTATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EF1_GNE

Protein Analysis

70

Amino Acids

7.73

Weight (kDa)

5.17

Isoelectric Point (pI)

24.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF1_GNE PF00736 1 - 58 3e-17 EF-1 guanine nucleotide exchange domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 83
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 3 cut(s) 10, 74, 191
AluI AGCT 3 cut(s) 10, 74, 191
Alw26I GTCTC 1 cut(s) 136
AseI ATTAAT 1 cut(s) 177
BciT130I CCWGG 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 128
BmsI GCATC 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 32
BsaI GGTCTC 1 cut(s) 136
BseBI CCWGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 136
Bso31I GGTCTC 1 cut(s) 136
BspTNI GGTCTC 1 cut(s) 136
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 166
BstC8I GCNNGC 2 cut(s) 47, 193
BstF5I GGATG 1 cut(s) 59
BstMAI GTCTC 1 cut(s) 136
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BtsCI GGATG 1 cut(s) 59
Cac8I GCNNGC 2 cut(s) 47, 193
CsiI ACCWGGT 1 cut(s) 126
Csp6I GTAC 1 cut(s) 82
CviJI RGCY 5 cut(s) 10, 20, 45, 74, 191
CviKI_1 RGCY 5 cut(s) 10, 20, 45, 74, 191
CviQI GTAC 1 cut(s) 82
Eco31I GGTCTC 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 126
FaiI YATR 1 cut(s) 205
FokI GGATG 1 cut(s) 46
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HindIII AAGCTT 1 cut(s) 8
Hpy166II GTNNAC 2 cut(s) 34, 139
Hpy8I GTNNAC 2 cut(s) 34, 139
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 166
HpyCH4V TGCA 3 cut(s) 49, 100, 195
LmnI GCTCC 2 cut(s) 56, 188
LpnPI CCDG 2 cut(s) 113, 140
LweI GCATC 1 cut(s) 68
MabI ACCWGGT 1 cut(s) 126
MfeI CAATTG 1 cut(s) 114
MluCI AATT 2 cut(s) 114, 174
MnlI CCTC 3 cut(s) 7, 10, 145
MseI TTAA 2 cut(s) 90, 177
MspR9I CCNGG 1 cut(s) 128
MunI CAATTG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 128
PflFI GACNNNGTC 1 cut(s) 128
PshBI ATTAAT 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PsyI GACNNNGTC 1 cut(s) 128
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SaqAI TTAA 2 cut(s) 90, 177
ScrFI CCNGG 1 cut(s) 128
SetI ASST 4 cut(s) 12, 76, 129, 193
SexAI ACCWGGT 1 cut(s) 126
SfaNI GCATC 1 cut(s) 68
SgeI CNNG 8 cut(s) 23, 49, 58, 80, 97, 139, 140, 204
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 2 cut(s) 114, 174
StyD4I CCNGG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 166
TaqI TCGA 1 cut(s) 168
TasI AATT 2 cut(s) 114, 174
Tru1I TTAA 2 cut(s) 90, 177
Tru9I TTAA 2 cut(s) 90, 177
TspDTI ATGAA 1 cut(s) 17
Tth111I GACNNNGTC 1 cut(s) 128
VspI ATTAAT 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.