pycom15g26070

Protein of unknown function (DUF568)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
20766517 .. 20766828
312 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 312 bp
ATGTTCGGAAACAACCCCGGATTGCACTCGCTTTCCGGACCCAACTTGCAATCCTTTGGAACTTTGGATTTTATTTCCGGGAAAATTGAAACAACCAAGAGAACGAGTACTTCGATAACCGCCTTAAAATATGCCCATGGAGTTGTCAATACCATTAGCTGGGGCATACTTATGCCCGTCGGCGTAATCGTGGCAAGGTATCTCCAGACGGTTGAAGATGGAGAAAACTCAGAAGTCGATGAGGAAATTGAAACGCCGATAAATGGAGTTGATTCTCATGACTCAGGGCAAAATGAAATACTGGAAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.06

Weight (kDa)

4.44

Isoelectric Point (pI)

41.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 159
AccIII TCCGGA 1 cut(s) 35
AciI CCGC 1 cut(s) 120
AfaI GTAC 1 cut(s) 109
AfiI CCNNNNNNNGG 2 cut(s) 159, 263
AgsI TTSAA 3 cut(s) 89, 215, 251
AluBI AGCT 2 cut(s) 159, 308
AluI AGCT 2 cut(s) 159, 308
Aor13HI TCCGGA 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 38
AsuC2I CCSGG 2 cut(s) 18, 79
AvaII GGWCC 1 cut(s) 38
BccI CCATC 1 cut(s) 212
BcnI CCSGG 2 cut(s) 18, 79
BmcAI AGTACT 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 18, 79
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmiI GGNNCC 1 cut(s) 40
BmrFI CCNGG 2 cut(s) 18, 79
BpmI CTGGAG 1 cut(s) 188
BpuMI CCSGG 2 cut(s) 18, 79
BsaJI CCNNGG 2 cut(s) 16, 136
BsaWI WCCGGW 1 cut(s) 35
Bsc4I CCNNNNNNNGG 2 cut(s) 159, 263
Bse1I ACTGG 1 cut(s) 306
BseAI TCCGGA 1 cut(s) 35
BseDI CCNNGG 2 cut(s) 16, 136
BseLI CCNNNNNNNGG 2 cut(s) 159, 263
BseMII CTCAG 2 cut(s) 243, 297
BseNI ACTGG 1 cut(s) 306
BseYI CCCAGC 1 cut(s) 159
BsiSI CCGG 3 cut(s) 18, 36, 78
BslI CCNNNNNNNGG 2 cut(s) 159, 263
Bsp13I TCCGGA 1 cut(s) 35
Bsp19I CCATGG 1 cut(s) 136
BspACI CCGC 1 cut(s) 120
BspCNI CTCAG 2 cut(s) 242, 296
BspEI TCCGGA 1 cut(s) 35
BspHI TCATGA 1 cut(s) 277
BspLI GGNNCC 1 cut(s) 40
BsrI ACTGG 1 cut(s) 306
BssECI CCNNGG 2 cut(s) 16, 136
BssT1I CCWWGG 1 cut(s) 136
Bst4CI ACNGT 1 cut(s) 211
BstDEI CTNAG 2 cut(s) 229, 283
BstDSI CCRYGG 1 cut(s) 136
BstSCI CCNGG 2 cut(s) 16, 77
BtgI CCRYGG 1 cut(s) 136
CciI TCATGA 1 cut(s) 277
Cfr13I GGNCC 1 cut(s) 38
Csp6I GTAC 1 cut(s) 108
CviAII CATG 2 cut(s) 137, 278
CviJI RGCY 2 cut(s) 159, 308
CviKI_1 RGCY 2 cut(s) 159, 308
CviQI GTAC 1 cut(s) 108
DdeI CTNAG 2 cut(s) 229, 283
Eco130I CCWWGG 1 cut(s) 136
Eco47I GGWCC 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 136
ErhI CCWWGG 1 cut(s) 136
FaeI CATG 2 cut(s) 140, 281
FaiI YATR 5 cut(s) 132, 138, 167, 173, 279
FatI CATG 2 cut(s) 136, 277
GsaI CCCAGC 1 cut(s) 163
GsuI CTGGAG 1 cut(s) 188
HapII CCGG 3 cut(s) 18, 36, 78
Hin1II CATG 2 cut(s) 140, 281
HindIII AAGCTT 1 cut(s) 306
HinfI GANTC 2 cut(s) 272, 281
HpaII CCGG 3 cut(s) 18, 36, 78
Hpy188I TCNGA 2 cut(s) 8, 232
Hpy188III TCNNGA 3 cut(s) 36, 205, 278
Hpy99I CGWCG 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 211
HpyCH4V TGCA 2 cut(s) 25, 49
HpyF3I CTNAG 2 cut(s) 229, 283
Hsp92II CATG 2 cut(s) 140, 281
Kpn2I TCCGGA 1 cut(s) 35
LpnPI CCDG 7 cut(s) 31, 49, 91, 145, 218, 270, 287
MboII GAAGA 1 cut(s) 227
MluCI AATT 2 cut(s) 84, 246
MlyI GAGTC 1 cut(s) 275
MnlI CCTC 1 cut(s) 235
MroI TCCGGA 1 cut(s) 35
MseI TTAA 2 cut(s) 125, 310
MslI CAYNNNNRTG 1 cut(s) 170
MspI CCGG 3 cut(s) 18, 36, 78
MspR9I CCNGG 2 cut(s) 18, 79
NciI CCSGG 2 cut(s) 18, 79
NcoI CCATGG 1 cut(s) 136
NlaIII CATG 2 cut(s) 140, 281
NlaIV GGNNCC 1 cut(s) 40
PagI TCATGA 1 cut(s) 277
PcsI WCGNNNNNNNCGW 2 cut(s) 110, 186
PfeI GAWTC 1 cut(s) 272
PflMI CCANNNNNTGG 1 cut(s) 159
PfoI TCCNGGA 1 cut(s) 77
PleI GAGTC 1 cut(s) 275
PpsI GAGTC 1 cut(s) 275
PspFI CCCAGC 1 cut(s) 159
PspN4I GGNNCC 1 cut(s) 40
PspPI GGNCC 1 cut(s) 38
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
RseI CAYNNNNRTG 1 cut(s) 170
SaqAI TTAA 2 cut(s) 125, 310
Sau96I GGNCC 1 cut(s) 38
ScaI AGTACT 1 cut(s) 109
SchI GAGTC 1 cut(s) 275
ScrFI CCNGG 2 cut(s) 18, 79
SetI ASST 3 cut(s) 161, 200, 310
SinI GGWCC 1 cut(s) 38
SmiMI CAYNNNNRTG 1 cut(s) 170
Sse9I AATT 2 cut(s) 84, 246
SsiI CCGC 1 cut(s) 120
StyD4I CCNGG 2 cut(s) 16, 77
StyI CCWWGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 211
TaqI TCGA 2 cut(s) 113, 237
TasI AATT 2 cut(s) 84, 246
TatI WGTACW 1 cut(s) 107
TfiI GAWTC 1 cut(s) 272
Tru1I TTAA 2 cut(s) 125, 310
Tru9I TTAA 2 cut(s) 125, 310
TspDTI ATGAA 1 cut(s) 309
Van91I CCANNNNNTGG 1 cut(s) 159
VpaK11BI GGWCC 1 cut(s) 38
ZrmI AGTACT 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.