Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010952.1

Orthogroup ID

OG0002816

Physical Location & Seq

Genomic Coordinates Reverse (-)

6431 .. 9702

Gene Structure 3272 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010952.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1755 bp

atgactaagattgttccttcactcttccttctctccctcttattcacttcttcattctcaaccctaaccgcacaaacctgctcaacccaccagttccctaaccacaaaacctttgcagcatgtaatgatctaccagtcctaaactccactatttactggaattatttcccatcaaacggaacagtagaccttgcattcagagaaaccctagtgggcgattctagatgggcggcgtgggcgataaaccctagttccaagggtatggtgggctcgcaagccttggtcgcttttcaaagaagtgatggaactatggctgtttattcgtcgcctataaaaagctacgacactcacttggagcaagggaacctctcctttcctgtctacaccttgtctgcggtttacgaaaacaaagaaatcactatctttgccaccctagggctcccaaacaatgttacaactatgaatcaactatggcaacaaggacctctgcatggtaacacaccaggtatggactcgatgtcaggccttaaccttaaatcctatggcaccttggattttctttccggcaaagtggaagcaaccggtacacatcactctgcggtgtctagcatgaaaatcgcccataggataatgaacaccattagttggggtatactcatgccaatagaagctatcgtggctcagaatttcaaagggtttggtccagcatggttctacattcacgtttcttgccaaatcttgggttctcttggtggaattgctggctcagtcaccggacttatgctaggtcacaagtcttcagggatcgaatacaaaggtcacaaatgcataggcatcacactgatgagtcttgccatagtccaggtgctagctgggttcctgttgcggcctaaaccggatcacaagtataggcggttctggaatttgtttcactatgcccttggttacagtgcaattgtccttggcatagtaaacatcttcaaagggtttgatatattgaaaccgccaaagtcgtggaggtatgcctatatggggattcttgctgcgttggtgtttctcgcgctccacagaggccggacgacgccgcataggacggagacgacgccacagaggccgaagatgatccctcagaggctgcaaatcgaggactctgttgagatcggacggcaacgagcacggtcgatttcggcgatctgggctttccggtctgcggtgccgattggagaagcagcattcactcctgaagacgaaaaagaagctttggtcggcctacctcgcaggagtccaacacctggtaggcgagaaacgcgtccggacaataaattcatacgccggaatcccaacaccaatccggtagccggattccggtcggccgtcggccactggtcatcggagtcgggcaagcacctgtccggctactccccggcaacagcgacggcctctggccttgccaatgcacgttgggtgcggccggacggagtggactcggggctttgctggggagtagcggcttcgggtgatggtcgtcattcggagggccacttcgacggattggatctgattttggctcgactgggtgcggcctggtgtgggatgatgattggtggtgtttctcgctggtggtctggcggtgacgacgtctttctgtccgacatcagtggaggagacggggtggaggcgctgcgaggctggtctagggctgggaagggttggggacggccatcttctggatttgctttctctgggctttggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko04141 map04141

Pfam Domains

Protein Families

Cytochrom_B561 DUF568

Protein Analysis

584

Amino Acids

63.65

Weight (kDa)

9.58

Isoelectric Point (pI)

46.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002816)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G59070 AT5G48750
fragaria_vesca	FvH4_1g16900 FvH4_1g19870
malus_domestica	MD02G1185700.v1.1 MD02G1186700.v1.1 MD15G1297900.v1.1
prunus_persica	Prupe.1G530600_v2.0.a1 Prupe.6G221100_v2.0.a1
pyrus_communis	pycom02g15060 pycom15g26070
rosa_chinensis	RchiOBHm_Chr2g0106931 RchiOBHm_Chr2g0107391 RchiOBHm_Chr2g0107401 RchiOBHm_Chr2g0158541
rosa_laevigata	RLG00000017544 RLG00000017577
rosa_multiflora	Rmu_sc0005896.1_g000001 Rmu_sc0010952.1_g000003 Rmu_sc0017496.1_g000004
rosa_roxburghii	Rroxscaffold_2G00091230 Rroxscaffold_2G00136380 Rroxscaffold_2G00136730
rosa_rugosa	Rorug02G0139300 Rorug02G0143100
rosa_samantha	Rh2AG190400 Rh2AG193300 Rh2AG535900 Rh2BG202000 Rh2BG205700 Rh2BG549100 Rh2CG195000 Rh2CG198600 Rh2CG198700 Rh2CG519600 Rh2DG197100 Rh2DG200600 Rh2DG558800
rosa_wichuraiana	Rw2G015320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	1641
Acc36I	ACCTGC	1 cut(s)	86
AccB1I	GGYRCC	2 cut(s)	545, 1213
AccB7I	CCANNNNNTGG	4 cut(s)	645, 739, 1292, 1727
AccI	GTMKAC	3 cut(s)	186, 381, 652
AccII	CGCG	2 cut(s)	1061, 1309
AccIII	TCCGGA	1 cut(s)	1312
AclWI	GGATC	4 cut(s)	812, 906, 1117, 1563
AcoI	YGGCCR	4 cut(s)	1371, 1378, 1469, 1718
AcsI	RAATTY	3 cut(s)	685, 922, 1322
AcuI	CTGAAG	2 cut(s)	783, 1263
AcyI	GRCGYC	3 cut(s)	1082, 1103, 1638
AfaI	GTAC	1 cut(s)	586
AflIII	ACRYGT	1 cut(s)	1307
AgeI	ACCGGT	1 cut(s)	581
AgsI	TTSAA	4 cut(s)	293, 691, 982, 1000
AhdI	GACNNNNNGTC	1 cut(s)	517
AjnI	CCWGG	4 cut(s)	502, 861, 1291, 1583
AluBI	AGCT	4 cut(s)	339, 671, 872, 1259
AluI	AGCT	4 cut(s)	339, 671, 872, 1259
Alw21I	GWGCWC	1 cut(s)	1177
Alw26I	GTCTC	2 cut(s)	1091, 1659
AlwI	GGATC	4 cut(s)	812, 906, 1117, 1563
AlwNI	CAGNNNCTG	1 cut(s)	1135
Ama87I	CYCGRG	1 cut(s)	1486
Aor13HI	TCCGGA	1 cut(s)	1312
ApeKI	GCWGC	5 cut(s)	116, 1043, 1135, 1229, 1681
ApoI	RAATTY	3 cut(s)	685, 922, 1322
AsiGI	ACCGGT	1 cut(s)	581
Asp700I	GAANNNNTTC	1 cut(s)	164
AspA2I	CCTAGG	1 cut(s)	433
AspLEI	GCGC	2 cut(s)	1063, 1681
AspS9I	GGNCC	3 cut(s)	482, 701, 1537
AsuC2I	CCSGG	1 cut(s)	1424
AsuHPI	GGTGA	3 cut(s)	763, 1529, 1643
AsuNHI	GCTAGC	1 cut(s)	868
AvaI	CYCGRG	1 cut(s)	1486
AvaII	GGWCC	2 cut(s)	482, 701
AvrII	CCTAGG	1 cut(s)	433
BanI	GGYRCC	2 cut(s)	545, 1213
BanII	GRGCYC	2 cut(s)	272, 441
BbsI	GAAGAC	2 cut(s)	789, 1251
Bbv12I	GWGCWC	1 cut(s)	1177
BbvI	GCAGC	5 cut(s)	128, 1030, 1122, 1241, 1668
BccI	CCATC	5 cut(s)	178, 219, 296, 1514, 1729
BceAI	ACGGC	4 cut(s)	1181, 1358, 1452, 1733
BcgI	CGANNNNNNTGC	2 cut(s)	598, 632
BciT130I	CCWGG	4 cut(s)	504, 863, 1293, 1585
BcnI	CCSGG	1 cut(s)	1424
BcoDI	GTCTC	2 cut(s)	1091, 1659
BfaI	CTAG	8 cut(s)	209, 222, 249, 434, 606, 785, 869, 1695
BfoI	RGCGCY	1 cut(s)	1682
BfuAI	ACCTGC	1 cut(s)	86
BglI	GCCNNNNNGGC	1 cut(s)	1111
BlnI	CCTAGG	1 cut(s)	433
Bme1390I	CCNGG	5 cut(s)	504, 863, 1293, 1424, 1585
Bme18I	GGWCC	2 cut(s)	482, 701
BmeRI	GACNNNNNGTC	1 cut(s)	517
BmeT110I	CYCGRG	1 cut(s)	1486
BmgT120I	GGNCC	3 cut(s)	482, 701, 1537
BmiI	GGNNCC	5 cut(s)	365, 440, 547, 878, 1215
BmrFI	CCNGG	5 cut(s)	504, 863, 1293, 1424, 1585
BmrI	ACTGGG	1 cut(s)	1583
BmsI	GCATC	1 cut(s)	843
BmtI	GCTAGC	1 cut(s)	872
BmuI	ACTGGG	1 cut(s)	1583
BpiI	GAAGAC	2 cut(s)	789, 1251
BpuMI	CCSGG	1 cut(s)	1424
BsaHI	GRCGYC	3 cut(s)	1082, 1103, 1638
BsaJI	CCNNGG	7 cut(s)	255, 279, 433, 549, 940, 961, 1422
BsaWI	WCCGGW	7 cut(s)	581, 773, 895, 1203, 1312, 1351, 1365
BsaXI	ACNNNNNCTCC	2 cut(s)	1656, 1686
Bse118I	RCCGGY	1 cut(s)	581
Bse1I	ACTGG	5 cut(s)	91, 134, 161, 1388, 1578
BseAI	TCCGGA	1 cut(s)	1312
BseBI	CCWGG	4 cut(s)	504, 863, 1293, 1585
BseDI	CCNNGG	7 cut(s)	255, 279, 433, 549, 940, 961, 1422
BseGI	GGATG	1 cut(s)	1599
BseMII	CTCAG	3 cut(s)	695, 780, 1142
BseNI	ACTGG	5 cut(s)	91, 134, 161, 1388, 1578
BseRI	GAGGAG	1 cut(s)	1677
BseX3I	CGGCCG	2 cut(s)	1371, 1469
BseXI	GCAGC	5 cut(s)	128, 1030, 1122, 1241, 1668
BseYI	CCCAGC	3 cut(s)	872, 1497, 1700
Bsh1236I	CGCG	2 cut(s)	1061, 1309
Bsh1285I	CGRYCG	4 cut(s)	1181, 1370, 1374, 1472
BshNI	GGYRCC	2 cut(s)	545, 1213
BshTI	ACCGGT	1 cut(s)	581
BsiEI	CGRYCG	4 cut(s)	1181, 1370, 1374, 1472
BsiHKAI	GWGCWC	1 cut(s)	1177
BsiHKCI	CYCGRG	1 cut(s)	1486
BslFI	GGGAC	1 cut(s)	1728
BsmAI	GTCTC	2 cut(s)	1091, 1659
BsmBI	CGTCTC	2 cut(s)	1091, 1659
BsmFI	GGGAC	1 cut(s)	1728
BsmI	GAATGC	2 cut(s)	194, 1232
BsoBI	CYCGRG	1 cut(s)	1486
Bsp1286I	GDGCHC	3 cut(s)	272, 441, 1177
Bsp13I	TCCGGA	1 cut(s)	1312
Bsp143I	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
BspCNI	CTCAG	3 cut(s)	694, 779, 1141
BspEI	TCCGGA	1 cut(s)	1312
BspFNI	CGCG	2 cut(s)	1061, 1309
BspLI	GGNNCC	5 cut(s)	365, 440, 547, 878, 1215
BspMI	ACCTGC	1 cut(s)	86
BspOI	GCTAGC	1 cut(s)	872
BspPI	GGATC	4 cut(s)	812, 906, 1117, 1563
BspT107I	GGYRCC	2 cut(s)	545, 1213
BsrFI	RCCGGY	1 cut(s)	581
BsrI	ACTGG	5 cut(s)	91, 134, 161, 1388, 1578
BssAI	RCCGGY	1 cut(s)	581
BssECI	CCNNGG	7 cut(s)	255, 279, 433, 549, 940, 961, 1422
BssMI	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
BssNAI	GTATAC	1 cut(s)	653
BssNI	GRCGYC	3 cut(s)	1082, 1103, 1638
BssT1I	CCWWGG	6 cut(s)	255, 279, 433, 549, 940, 961
Bst1107I	GTATAC	1 cut(s)	653
Bst2UI	CCWGG	4 cut(s)	504, 863, 1293, 1585
Bst4CI	ACNGT	3 cut(s)	184, 950, 1179
Bst6I	CTCTTC	1 cut(s)	29
BstACI	GRCGYC	3 cut(s)	1082, 1103, 1638
BstC8I	GCNNGC	5 cut(s)	272, 276, 763, 870, 1403
BstDEI	CTNAG	4 cut(s)	6, 681, 766, 1128
BstF5I	GGATG	1 cut(s)	1599
BstFNI	CGCG	2 cut(s)	1061, 1309
BstH2I	RGCGCY	1 cut(s)	1682
BstHHI	GCGC	2 cut(s)	1063, 1681
BstKTI	GATC	7 cut(s)	130, 807, 901, 1125, 1161, 1194, 1558
BstMAI	GTCTC	2 cut(s)	1091, 1659
BstMBI	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
BstMCI	CGRYCG	4 cut(s)	1181, 1370, 1374, 1472
BstMWI	GCNNNNNNNGC	7 cut(s)	236, 284, 677, 1111, 1196, 1275, 1306
BstNI	CCWGG	4 cut(s)	504, 863, 1293, 1585
BstNSI	RCATGY	1 cut(s)	123
BstSCI	CCNGG	5 cut(s)	502, 861, 1291, 1422, 1583
BstUI	CGCG	2 cut(s)	1061, 1309
BstV1I	GCAGC	5 cut(s)	128, 1030, 1122, 1241, 1668
BstV2I	GAAGAC	2 cut(s)	789, 1251
BstX2I	RGATCY	1 cut(s)	1555
BstXI	CCANNNNNNTGG	2 cut(s)	262, 1014
BstYI	RGATCY	1 cut(s)	1555
BstZ17I	GTATAC	1 cut(s)	653
BstZI	CGGCCG	2 cut(s)	1371, 1469
BtsCI	GGATG	1 cut(s)	1599
BtsIMutI	CAGTG	4 cut(s)	839, 955, 1381, 1663
BveI	ACCTGC	1 cut(s)	86
Cac8I	GCNNGC	5 cut(s)	272, 276, 763, 870, 1403
CaiI	CAGNNNCTG	1 cut(s)	1135
CfoI	GCGC	2 cut(s)	1063, 1681
Cfr10I	RCCGGY	1 cut(s)	581
Cfr13I	GGNCC	3 cut(s)	482, 701, 1537
CseI	GACGC	3 cut(s)	1090, 1111, 1298
CsiI	ACCWGGT	2 cut(s)	502, 1291
Csp6I	GTAC	1 cut(s)	585
CspAI	ACCGGT	1 cut(s)	581
CviAII	CATG	5 cut(s)	120, 491, 610, 658, 708
CviQI	GTAC	1 cut(s)	585
DdeI	CTNAG	4 cut(s)	6, 681, 766, 1128
DpnI	GATC	7 cut(s)	129, 806, 900, 1124, 1160, 1193, 1557
DpnII	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
DriI	GACNNNNNGTC	1 cut(s)	517
EaeI	YGGCCR	4 cut(s)	1371, 1378, 1469, 1718
EagI	CGGCCG	2 cut(s)	1371, 1469
Eam1104I	CTCTTC	1 cut(s)	29
Eam1105I	GACNNNNNGTC	1 cut(s)	517
EarI	CTCTTC	1 cut(s)	29
EclXI	CGGCCG	2 cut(s)	1371, 1469
Eco130I	CCWWGG	6 cut(s)	255, 279, 433, 549, 940, 961
Eco147I	AGGCCT	1 cut(s)	525
Eco24I	GRGCYC	2 cut(s)	272, 441
Eco47I	GGWCC	2 cut(s)	482, 701
Eco52I	CGGCCG	2 cut(s)	1371, 1469
Eco57I	CTGAAG	2 cut(s)	783, 1263
Eco88I	CYCGRG	1 cut(s)	1486
EcoO109I	RGGNCCY	1 cut(s)	482
EcoRII	CCWGG	4 cut(s)	502, 861, 1291, 1583
EcoT14I	CCWWGG	6 cut(s)	255, 279, 433, 549, 940, 961
EcoT22I	ATGCAT	1 cut(s)	830
EcoT38I	GRGCYC	2 cut(s)	272, 441
ErhI	CCWWGG	6 cut(s)	255, 279, 433, 549, 940, 961
Esp3I	CGTCTC	2 cut(s)	1091, 1659
FaeI	CATG	5 cut(s)	123, 494, 613, 661, 711
FaqI	GGGAC	1 cut(s)	1728
FatI	CATG	5 cut(s)	119, 490, 609, 657, 707
FblI	GTMKAC	3 cut(s)	186, 381, 652
FokI	GGATG	1 cut(s)	1606
FriOI	GRGCYC	2 cut(s)	272, 441
FspBI	CTAG	8 cut(s)	209, 222, 249, 434, 606, 785, 869, 1695
GlaI	GCGC	2 cut(s)	1062, 1680
GsaI	CCCAGC	3 cut(s)	876, 1501, 1704
HaeII	RGCGCY	1 cut(s)	1682
HgaI	GACGC	3 cut(s)	1090, 1111, 1298
HhaI	GCGC	2 cut(s)	1063, 1681
Hin1I	GRCGYC	3 cut(s)	1082, 1103, 1638
Hin1II	CATG	5 cut(s)	123, 494, 613, 661, 711
Hin6I	GCGC	2 cut(s)	1061, 1679
HinP1I	GCGC	2 cut(s)	1061, 1679
HindIII	AAGCTT	1 cut(s)	1257
HphI	GGTGA	3 cut(s)	763, 1529, 1643
Hpy166II	GTNNAC	7 cut(s)	187, 382, 400, 587, 653, 973, 1483
Hpy188I	TCNGA	8 cut(s)	200, 684, 1131, 1163, 1393, 1534, 1560, 1651
Hpy188III	TCNNGA	5 cut(s)	222, 919, 1241, 1313, 1728
Hpy8I	GTNNAC	7 cut(s)	187, 382, 400, 587, 653, 973, 1483
Hpy99I	CGWCG	7 cut(s)	328, 1084, 1105, 1379, 1438, 1550, 1640
HpyAV	CCTTC	3 cut(s)	27, 38, 1699
HpyCH4III	ACNGT	3 cut(s)	184, 950, 1179
HpyCH4IV	ACGT	3 cut(s)	723, 1459, 1638
HpyCH4V	TGCA	7 cut(s)	116, 194, 490, 828, 953, 1138, 1457
HpyF10VI	GCNNNNNNNGC	7 cut(s)	236, 284, 677, 1111, 1196, 1275, 1306
HpyF3I	CTNAG	4 cut(s)	6, 681, 766, 1128
HpySE526I	ACGT	3 cut(s)	723, 1459, 1638
Hsp92I	GRCGYC	3 cut(s)	1082, 1103, 1638
Hsp92II	CATG	5 cut(s)	123, 494, 613, 661, 711
HspAI	GCGC	2 cut(s)	1061, 1679
Kpn2I	TCCGGA	1 cut(s)	1312
Kzo9I	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
LmnI	GCTCC	3 cut(s)	355, 444, 1068
Lsp1109I	GCAGC	5 cut(s)	128, 1030, 1122, 1241, 1668
LweI	GCATC	1 cut(s)	843
MabI	ACCWGGT	2 cut(s)	502, 1291
MaeI	CTAG	8 cut(s)	209, 222, 249, 434, 606, 785, 869, 1695
MaeII	ACGT	3 cut(s)	723, 1459, 1638
MaeIII	GTNAC	7 cut(s)	451, 494, 769, 788, 818, 944, 1631
MalI	GATC	7 cut(s)	129, 806, 900, 1124, 1160, 1193, 1557
MboI	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
MboII	GAAGA	7 cut(s)	16, 42, 789, 970, 1129, 1256, 1716
MfeI	CAATTG	1 cut(s)	954
MflI	RGATCY	1 cut(s)	1555
MhlI	GDGCHC	3 cut(s)	272, 441, 1177
MluCI	AATT	6 cut(s)	160, 685, 756, 922, 954, 1322
MluI	ACGCGT	1 cut(s)	1307
MlyI	GAGTC	6 cut(s)	506, 856, 1142, 1291, 1403, 1478
MmeI	TCCRAC	2 cut(s)	1310, 1674
Mph1103I	ATGCAT	1 cut(s)	830
MroI	TCCGGA	1 cut(s)	1312
MroXI	GAANNNNTTC	1 cut(s)	164
MseI	TTAA	2 cut(s)	528, 534
MslI	CAYNNNNRTG	1 cut(s)	842
MspR9I	CCNGG	5 cut(s)	504, 863, 1293, 1424, 1585
MunI	CAATTG	1 cut(s)	954
Mva1269I	GAATGC	2 cut(s)	194, 1232
MvaI	CCWGG	4 cut(s)	504, 863, 1293, 1585
MvnI	CGCG	2 cut(s)	1061, 1309
MwoI	GCNNNNNNNGC	7 cut(s)	236, 284, 677, 1111, 1196, 1275, 1306
NciI	CCSGG	1 cut(s)	1424
NdeII	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
NheI	GCTAGC	1 cut(s)	868
NlaIII	CATG	5 cut(s)	123, 494, 613, 661, 711
NlaIV	GGNNCC	5 cut(s)	365, 440, 547, 878, 1215
NmuCI	GTSAC	4 cut(s)	769, 788, 818, 1631
NsiI	ATGCAT	1 cut(s)	830
NspI	RCATGY	1 cut(s)	123
PceI	AGGCCT	1 cut(s)	525
PcsI	WCGNNNNNNNCGW	1 cut(s)	1187
PctI	GAATGC	2 cut(s)	194, 1232
PdmI	GAANNNNTTC	1 cut(s)	164
PfeI	GAWTC	5 cut(s)	218, 463, 1036, 1336, 1362
PflFI	GACNNNGTC	1 cut(s)	1637
PflMI	CCANNNNNTGG	4 cut(s)	645, 739, 1292, 1727
PinAI	ACCGGT	1 cut(s)	581
PleI	GAGTC	6 cut(s)	506, 855, 1142, 1290, 1402, 1478
PpsI	GAGTC	6 cut(s)	506, 855, 1142, 1290, 1402, 1478
PpuMI	RGGWCCY	1 cut(s)	482
Psp5II	RGGWCCY	1 cut(s)	482
Psp6I	CCWGG	4 cut(s)	502, 861, 1291, 1583
PspFI	CCCAGC	3 cut(s)	872, 1497, 1700
PspGI	CCWGG	4 cut(s)	502, 861, 1291, 1583
PspN4I	GGNNCC	5 cut(s)	365, 440, 547, 878, 1215
PspPI	GGNCC	3 cut(s)	482, 701, 1537
PspPPI	RGGWCCY	1 cut(s)	482
PsrI	GAACNNNNNNTAC	2 cut(s)	899, 931
PstNI	CAGNNNCTG	1 cut(s)	1135
PsuI	RGATCY	1 cut(s)	1555
PsyI	GACNNNGTC	1 cut(s)	1637
RsaI	GTAC	1 cut(s)	586
RsaNI	GTAC	1 cut(s)	585
RseI	CAYNNNNRTG	1 cut(s)	842
SaqAI	TTAA	2 cut(s)	528, 534
Sau3AI	GATC	7 cut(s)	127, 804, 898, 1122, 1158, 1191, 1555
Sau96I	GGNCC	3 cut(s)	482, 701, 1537
SchI	GAGTC	6 cut(s)	506, 856, 1142, 1291, 1403, 1478
ScrFI	CCNGG	5 cut(s)	504, 863, 1293, 1424, 1585
SduI	GDGCHC	3 cut(s)	272, 441, 1177
SexAI	ACCWGGT	2 cut(s)	502, 1291
SfaNI	GCATC	1 cut(s)	843
SinI	GGWCC	2 cut(s)	482, 701
SmiMI	CAYNNNNRTG	1 cut(s)	842
Sse9I	AATT	6 cut(s)	160, 685, 756, 922, 954, 1322
SseBI	AGGCCT	1 cut(s)	525
SspMI	CTAG	8 cut(s)	209, 222, 249, 434, 606, 785, 869, 1695
StuI	AGGCCT	1 cut(s)	525
StyD4I	CCNGG	5 cut(s)	502, 861, 1291, 1422, 1583
StyI	CCWWGG	6 cut(s)	255, 279, 433, 549, 940, 961
TaaI	ACNGT	3 cut(s)	184, 950, 1179
TaiI	ACGT	3 cut(s)	726, 1462, 1641
TaqI	TCGA	6 cut(s)	515, 807, 1143, 1181, 1545, 1570
TasI	AATT	6 cut(s)	160, 685, 756, 922, 954, 1322
TauI	GCSGC	6 cut(s)	233, 889, 1087, 1471, 1511, 1583
TfiI	GAWTC	5 cut(s)	218, 463, 1036, 1336, 1362
Tru1I	TTAA	2 cut(s)	528, 534
Tru9I	TTAA	2 cut(s)	528, 534
TscAI	CASTG	4 cut(s)	846, 955, 1388, 1663
TseFI	GTSAC	4 cut(s)	769, 788, 818, 1631
TseI	GCWGC	5 cut(s)	116, 1043, 1135, 1229, 1681
Tsp45I	GTSAC	4 cut(s)	769, 788, 818, 1631
TspDTI	ATGAA	5 cut(s)	42, 476, 626, 647, 1315
TspGWI	ACGGA	4 cut(s)	192, 1109, 1491, 1563
TspRI	CASTG	4 cut(s)	846, 955, 1388, 1663
Tth111I	GACNNNGTC	1 cut(s)	1637
Van91I	CCANNNNNTGG	4 cut(s)	645, 739, 1292, 1727
VpaK11BI	GGWCC	2 cut(s)	482, 701
XapI	RAATTY	3 cut(s)	685, 922, 1322
XbaI	TCTAGA	1 cut(s)	221
XceI	RCATGY	1 cut(s)	123
XcmI	CCANNNNNNNNNTGG	2 cut(s)	262, 869
XmaJI	CCTAGG	1 cut(s)	433
XmiI	GTMKAC	3 cut(s)	186, 381, 652
XmnI	GAANNNNTTC	1 cut(s)	164
XspI	CTAG	8 cut(s)	209, 222, 249, 434, 606, 785, 869, 1695
ZraI	GACGTC	1 cut(s)	1639
Zsp2I	ATGCAT	1 cut(s)	830

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.