pycom17g14320

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
11817053 .. 11818242
1190 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g14320.2

Sequence Viewer

Length: 255 bp
ATGTTTCTGATGATGGATACCTTGCAAAGTTGCAATGCAATCGAGGACGACGGCACCTCGCTTTCCCTGTTCTGGGCAGTATTATATCAATTTAAAAGGACAGGGATTAGAGGCTGCCTGTTTTGCCATGCAAGAGTTCAACAAAATAACCAACTGCAGTTTATTAGAATGTTGTGTGCTAACAGGCGGAGGCTTAACAATGGTCCTCATTACATGTATTTTATATTGCTCGAGGCAATGATGGTGGTGAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.89

Weight (kDa)

8.88

Isoelectric Point (pI)

61.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 53
AciI CCGC 1 cut(s) 187
AfiI CCNNNNNNNGG 2 cut(s) 72, 73
AflIII ACRYGT 1 cut(s) 213
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 1 cut(s) 252
AluI AGCT 1 cut(s) 252
Ama87I CYCGRG 1 cut(s) 230
ApeKI GCWGC 1 cut(s) 114
AspS9I GGNCC 1 cut(s) 203
AvaI CYCGRG 1 cut(s) 230
AvaII GGWCC 1 cut(s) 203
BanI GGYRCC 1 cut(s) 53
BbvI GCAGC 1 cut(s) 101
BccI CCATC 2 cut(s) 7, 235
BceAI ACGGC 1 cut(s) 67
BcgI CGANNNNNNTGC 2 cut(s) 22, 56
BciVI GTATCC 1 cut(s) 10
BfmI CTRYAG 1 cut(s) 155
BfuI GTATCC 1 cut(s) 10
BisI GCNGC 1 cut(s) 115
BlsI GCNGC 1 cut(s) 116
Bme18I GGWCC 1 cut(s) 203
BmeT110I CYCGRG 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 203
BmiI GGNNCC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 2 cut(s) 72, 73
Bse3DI GCAATG 2 cut(s) 40, 243
BseLI CCNNNNNNNGG 2 cut(s) 72, 73
BseMI GCAATG 2 cut(s) 40, 243
BseXI GCAGC 1 cut(s) 101
BshNI GGYRCC 1 cut(s) 53
BsiHKCI CYCGRG 1 cut(s) 230
BslI CCNNNNNNNGG 2 cut(s) 72, 73
BsoBI CYCGRG 1 cut(s) 230
BspACI CCGC 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 55
BspMAI CTGCAG 1 cut(s) 159
BspT107I GGYRCC 1 cut(s) 53
BsrDI GCAATG 2 cut(s) 40, 243
BstMWI GCNNNNNNNGC 1 cut(s) 123
BstNSI RCATGY 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 155
BstV1I GCAGC 1 cut(s) 101
BsuI GTATCC 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 203
CspCI CAANNNNNGTGG 1 cut(s) 225
CviAII CATG 2 cut(s) 128, 214
CviJI RGCY 3 cut(s) 114, 193, 252
CviKI_1 RGCY 3 cut(s) 114, 193, 252
DraI TTTAAA 1 cut(s) 94
EciI GGCGGA 1 cut(s) 202
Eco47I GGWCC 1 cut(s) 203
Eco88I CYCGRG 1 cut(s) 230
FaeI CATG 2 cut(s) 131, 217
FaiI YATR 4 cut(s) 85, 129, 215, 224
FatI CATG 2 cut(s) 127, 213
Fnu4HI GCNGC 1 cut(s) 115
Fsp4HI GCNGC 1 cut(s) 115
GluI GCNGC 1 cut(s) 115
Hin1II CATG 2 cut(s) 131, 217
Hpy188I TCNGA 1 cut(s) 9
Hpy99I CGWCG 1 cut(s) 53
HpyCH4V TGCA 5 cut(s) 25, 33, 38, 131, 157
HpyF10VI GCNNNNNNNGC 1 cut(s) 123
Hsp92II CATG 2 cut(s) 131, 217
LpnPI CCDG 5 cut(s) 58, 80, 87, 131, 169
Lsp1109I GCAGC 1 cut(s) 101
MluCI AATT 1 cut(s) 89
MnlI CCTC 6 cut(s) 37, 67, 104, 183, 216, 226
MseI TTAA 2 cut(s) 93, 195
MwoI GCNNNNNNNGC 1 cut(s) 123
NlaIII CATG 2 cut(s) 131, 217
NlaIV GGNNCC 1 cut(s) 55
NspI RCATGY 1 cut(s) 217
PaeR7I CTCGAG 1 cut(s) 230
PciI ACATGT 1 cut(s) 213
PkrI GCNGC 1 cut(s) 116
PscI ACATGT 1 cut(s) 213
PspN4I GGNNCC 1 cut(s) 55
PspPI GGNCC 1 cut(s) 203
PspXI VCTCGAGB 1 cut(s) 230
PstI CTGCAG 1 cut(s) 159
SaqAI TTAA 2 cut(s) 93, 195
SatI GCNGC 1 cut(s) 115
Sau96I GGNCC 1 cut(s) 203
SetI ASST 3 cut(s) 23, 59, 254
SfcI CTRYAG 1 cut(s) 155
Sfr274I CTCGAG 1 cut(s) 230
SinI GGWCC 1 cut(s) 203
SlaI CTCGAG 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
Sse9I AATT 1 cut(s) 89
SsiI CCGC 1 cut(s) 187
TaqI TCGA 2 cut(s) 42, 231
TasI AATT 1 cut(s) 89
Tru1I TTAA 2 cut(s) 93, 195
Tru9I TTAA 2 cut(s) 93, 195
TseI GCWGC 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 203
XceI RCATGY 1 cut(s) 217
XhoI CTCGAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.