RchiOBHm_Chr5g0032131
ERF Family

Thioesterase superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
25818616 .. 25821419
2804 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGGCATCCTTAAGCCCCTCAACATTCAACAAGGCTGTGTCATCTACCCCTTTCTCCGTTAAACCTGCTTTTATTAACTTTTTTGGTGGATTCCATGGAGGAGCTATAGCTTCTATTGCTGAGGCTGTGTTAGTAGCTACTGCAAGAACGGTTGTGGTTGAGGATAAGGAGCTTTTTCTAGGGGAACTGAGCATCTCTTACCTCTCTTCTGCTCCAAAGAATGTTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

7.89

Weight (kDa)

6.53

Isoelectric Point (pI)

35.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 73
AflII CTTAAG 1 cut(s) 10
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 4 cut(s) 104, 110, 137, 172
AluI AGCT 4 cut(s) 104, 110, 137, 172
BbvCI CCTCAGC 1 cut(s) 120
BfaI CTAG 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 105
BfrI CTTAAG 1 cut(s) 10
BfuAI ACCTGC 1 cut(s) 73
BmsI GCATC 2 cut(s) 14, 201
Bpu10I CCTNAGC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 1 cut(s) 5
BseMII CTCAG 2 cut(s) 111, 179
BseRI GAGGAG 1 cut(s) 114
Bsp19I CCATGG 1 cut(s) 94
BspCNI CTCAG 2 cut(s) 112, 180
BspMI ACCTGC 1 cut(s) 73
BspTI CTTAAG 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 94
BssT1I CCWWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 151
Bst6I CTCTTC 1 cut(s) 211
BstAFI CTTAAG 1 cut(s) 10
BstDEI CTNAG 2 cut(s) 120, 188
BstDSI CCRYGG 1 cut(s) 94
BstF5I GGATG 1 cut(s) 5
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 105
BtgI CCRYGG 1 cut(s) 94
BtsCI GGATG 1 cut(s) 5
BveI ACCTGC 1 cut(s) 73
CviAII CATG 1 cut(s) 95
CviJI RGCY 7 cut(s) 15, 35, 104, 110, 125, 137, 172
CviKI_1 RGCY 7 cut(s) 15, 35, 104, 110, 125, 137, 172
DdeI CTNAG 2 cut(s) 120, 188
Eam1104I CTCTTC 1 cut(s) 211
EarI CTCTTC 1 cut(s) 211
Eco130I CCWWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 98
FaiI YATR 2 cut(s) 96, 107
FatI CATG 1 cut(s) 94
FspBI CTAG 1 cut(s) 179
Hin1II CATG 1 cut(s) 98
HinfI GANTC 1 cut(s) 90
HpyCH4III ACNGT 1 cut(s) 151
HpyCH4V TGCA 1 cut(s) 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 2 cut(s) 120, 188
Hsp92II CATG 1 cut(s) 98
LmnI GCTCC 3 cut(s) 101, 169, 217
LpnPI CCDG 1 cut(s) 78
LweI GCATC 2 cut(s) 14, 201
MaeI CTAG 1 cut(s) 179
MboII GAAGA 1 cut(s) 198
MnlI CCTC 5 cut(s) 28, 92, 115, 154, 212
MseI TTAA 3 cut(s) 11, 60, 75
MspCI CTTAAG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 116
NcoI CCATGG 1 cut(s) 94
NlaIII CATG 1 cut(s) 98
PfeI GAWTC 1 cut(s) 90
SaqAI TTAA 3 cut(s) 11, 60, 75
SetI ASST 6 cut(s) 67, 106, 112, 139, 174, 204
SfaNI GCATC 2 cut(s) 14, 201
SfcI CTRYAG 1 cut(s) 105
SgeI CNNG 5 cut(s) 43, 77, 107, 156, 191
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
SspMI CTAG 1 cut(s) 179
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 90
Tru1I TTAA 3 cut(s) 11, 60, 75
Tru9I TTAA 3 cut(s) 11, 60, 75
TspGWI ACGGA 1 cut(s) 46
Vha464I CTTAAG 1 cut(s) 10
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.