Rmu_sc0006445.1_g000014
ERF Family

Thioesterase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006445.1
OG0002384
Physical Location & Seq
Reverse (-)
64907 .. 65650
744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006445.1_g000014.1.cds

Sequence Viewer

Length: 303 bp
atgaacagtgatgaatacatccatctccctgagcaacacgtcaaggatatgctgcattttctcaaaggagtgggtatctccgaccctgttccagatcactgcgagaccaaacacttctactcctacctcgttcgtggcatccttaagcccctcaacattcaacgaggccgtgtcacctgcctcgtcaccgttaaacctgcttttattaactcttttggtggattccatggaggagctatagctgctgttgctgaggctgtgtcggtagctactgcgagaacggttgtggctgaggattcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
4HBT

Protein Analysis

100

Amino Acids

10.89

Weight (kDa)

6.57

Isoelectric Point (pI)

25.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 185
Acc36I ACCTGC 2 cut(s) 185, 205
AflII CTTAAG 1 cut(s) 143
AflIII ACRYGT 1 cut(s) 37
AgsI TTSAA 1 cut(s) 161
AjiI CACGTC 1 cut(s) 40
AluBI AGCT 3 cut(s) 236, 242, 269
AluI AGCT 3 cut(s) 236, 242, 269
Alw26I GTCTC 1 cut(s) 98
AoxI GGCC 1 cut(s) 166
ApeKI GCWGC 2 cut(s) 52, 242
AsuHPI GGTGA 2 cut(s) 166, 178
BbvCI CCTCAGC 2 cut(s) 252, 291
BbvI GCAGC 2 cut(s) 39, 229
BccI CCATC 1 cut(s) 30
BceAI ACGGC 1 cut(s) 153
BcoDI GTCTC 1 cut(s) 98
BfmI CTRYAG 1 cut(s) 237
BfrI CTTAAG 1 cut(s) 143
BfuAI ACCTGC 2 cut(s) 185, 205
BisI GCNGC 2 cut(s) 53, 243
BlsI GCNGC 2 cut(s) 54, 244
BmgBI CACGTC 1 cut(s) 40
BmsI GCATC 1 cut(s) 147
Bpu10I CCTNAGC 3 cut(s) 30, 252, 291
BsaI GGTCTC 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 226
BsaXI ACNNNNNCTCC 2 cut(s) 104, 134
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 2 cut(s) 18, 138
BseMII CTCAG 3 cut(s) 21, 243, 282
BseRI GAGGAG 1 cut(s) 246
BseXI GCAGC 2 cut(s) 39, 229
BshFI GGCC 1 cut(s) 168
BsmAI GTCTC 1 cut(s) 98
BsnI GGCC 1 cut(s) 168
Bso31I GGTCTC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 94
Bsp19I CCATGG 1 cut(s) 226
BspANI GGCC 1 cut(s) 168
BspCNI CTCAG 3 cut(s) 22, 244, 283
BspMI ACCTGC 2 cut(s) 185, 205
BspTI CTTAAG 1 cut(s) 143
BspTNI GGTCTC 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 226
BssMI GATC 1 cut(s) 94
BssT1I CCWWGG 1 cut(s) 226
Bst4CI ACNGT 3 cut(s) 8, 190, 283
BstAFI CTTAAG 1 cut(s) 143
BstDEI CTNAG 3 cut(s) 30, 252, 291
BstDSI CCRYGG 1 cut(s) 226
BstF5I GGATG 2 cut(s) 18, 138
BstKTI GATC 1 cut(s) 97
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 1 cut(s) 94
BstMWI GCNNNNNNNGC 2 cut(s) 242, 248
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 2 cut(s) 39, 229
BsuRI GGCC 1 cut(s) 168
BtgI CCRYGG 1 cut(s) 226
BtrI CACGTC 1 cut(s) 40
BtsCI GGATG 2 cut(s) 18, 138
BtsI GCAGTG 1 cut(s) 97
BtsIMutI CAGTG 2 cut(s) 13, 97
BveI ACCTGC 2 cut(s) 185, 205
CviAII CATG 1 cut(s) 227
CviJI RGCY 7 cut(s) 148, 168, 236, 242, 257, 269, 290
CviKI_1 RGCY 7 cut(s) 148, 168, 236, 242, 257, 269, 290
DdeI CTNAG 3 cut(s) 30, 252, 291
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco130I CCWWGG 1 cut(s) 226
Eco31I GGTCTC 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 226
ErhI CCWWGG 1 cut(s) 226
FaeI CATG 1 cut(s) 230
FaiI YATR 3 cut(s) 50, 228, 239
FatI CATG 1 cut(s) 226
Fnu4HI GCNGC 2 cut(s) 53, 243
FokI GGATG 2 cut(s) 5, 125
Fsp4HI GCNGC 2 cut(s) 53, 243
GluI GCNGC 2 cut(s) 53, 243
HaeIII GGCC 1 cut(s) 168
Hin1II CATG 1 cut(s) 230
HinfI GANTC 2 cut(s) 222, 296
HphI GGTGA 2 cut(s) 166, 178
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 92, 300
HpyCH4III ACNGT 3 cut(s) 8, 190, 283
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 2 cut(s) 242, 248
HpyF3I CTNAG 3 cut(s) 30, 252, 291
HpySE526I ACGT 1 cut(s) 39
Hsp92II CATG 1 cut(s) 230
Kzo9I GATC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 233
LpnPI CCDG 5 cut(s) 42, 99, 105, 190, 210
Lsp1109I GCAGC 2 cut(s) 39, 229
LweI GCATC 1 cut(s) 147
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 172, 184
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 7 cut(s) 137, 158, 161, 191, 224, 247, 286
MseI TTAA 3 cut(s) 144, 192, 207
MspCI CTTAAG 1 cut(s) 143
MwoI GCNNNNNNNGC 2 cut(s) 242, 248
NcoI CCATGG 1 cut(s) 226
NdeII GATC 1 cut(s) 94
NlaIII CATG 1 cut(s) 230
NmuCI GTSAC 2 cut(s) 172, 184
PaqCI CACCTGC 1 cut(s) 185
PfeI GAWTC 2 cut(s) 222, 296
PkrI GCNGC 2 cut(s) 54, 244
SaqAI TTAA 3 cut(s) 144, 192, 207
SatI GCNGC 2 cut(s) 53, 243
Sau3AI GATC 1 cut(s) 94
SetI ASST 7 cut(s) 42, 129, 179, 199, 238, 244, 271
SfaNI GCATC 1 cut(s) 147
SfcI CTRYAG 1 cut(s) 237
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 226
TaaI ACNGT 3 cut(s) 8, 190, 283
TaiI ACGT 1 cut(s) 42
TfiI GAWTC 2 cut(s) 222, 296
Tru1I TTAA 3 cut(s) 144, 192, 207
Tru9I TTAA 3 cut(s) 144, 192, 207
TscAI CASTG 2 cut(s) 13, 104
TseFI GTSAC 2 cut(s) 172, 184
TseI GCWGC 2 cut(s) 52, 242
Tsp45I GTSAC 2 cut(s) 172, 184
TspDTI ATGAA 2 cut(s) 17, 27
TspRI CASTG 2 cut(s) 13, 104
Vha464I CTTAAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.