Rh3DG320000
ERF Family

Thioesterase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0002384
Physical Location & Seq
Reverse (-)
34680954 .. 34682315
1362 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG320000.1

Sequence Viewer

Length: 300 bp
ATGATCTTGTGCTCTGAACGTGATACGGCAAAGCTAGATAGGCGAAAGAGGAAGGATGAGCGCCAAAGAGAGGCATTGGACCAATTGGGACATGTGGATGAAATTGTAAATGACCTCACTATAAATTTGAATTCCCAACTCCAGACGACAGATCTGGCAGAGGTGATAGTTGATGGATCTGTAGTTCGGAGTGGAAGAAATCTTACTGTAATAGCACAGGAGTTCAAGCTCAAGAAAACTGGAAACTTGATCTACACTGCTCGTGCTACCTTCTATCACATGCCTGTTTCGAAATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
4HBT

Protein Analysis

99

Amino Acids

11.31

Weight (kDa)

8.85

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 184
AcsI RAATTY 2 cut(s) 124, 130
AfiI CCNNNNNNNGG 1 cut(s) 70
AflIII ACRYGT 1 cut(s) 91
AgsI TTSAA 2 cut(s) 130, 226
AloI GAACNNNNNNTCC 2 cut(s) 168, 200
AluBI AGCT 2 cut(s) 34, 229
AluI AGCT 2 cut(s) 34, 229
Alw21I GWGCWC 1 cut(s) 14
AlwI GGATC 1 cut(s) 184
ApoI RAATTY 2 cut(s) 124, 130
AspLEI GCGC 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 175
AsuII TTCGAA 1 cut(s) 290
AvaII GGWCC 1 cut(s) 79
BarI GAAGNNNNNNTAC 2 cut(s) 187, 219
BauI CACGAG 1 cut(s) 261
Bbv12I GWGCWC 1 cut(s) 14
BccI CCATC 1 cut(s) 167
BceAI ACGGC 1 cut(s) 42
BfaI CTAG 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 180
BfoI RGCGCY 1 cut(s) 64
BglII AGATCT 1 cut(s) 151
Bme18I GGWCC 1 cut(s) 79
BmgT120I GGNCC 1 cut(s) 79
BpmI CTGGAG 1 cut(s) 125
Bpu14I TTCGAA 1 cut(s) 290
BpuEI CTTGAG 1 cut(s) 215
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse1I ACTGG 1 cut(s) 244
BseGI GGATG 2 cut(s) 61, 103
BseLI CCNNNNNNNGG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 244
BsiHKAI GWGCWC 1 cut(s) 14
BslFI GGGAC 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 70
BsmFI GGGAC 1 cut(s) 102
Bsp119I TTCGAA 1 cut(s) 290
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 4 cut(s) 3, 151, 176, 249
BspPI GGATC 1 cut(s) 184
BspT104I TTCGAA 1 cut(s) 290
BsrI ACTGG 1 cut(s) 244
BssMI GATC 4 cut(s) 3, 151, 176, 249
BssSI CACGAG 1 cut(s) 261
Bst2BI CACGAG 1 cut(s) 261
Bst4CI ACNGT 1 cut(s) 208
BstBI TTCGAA 1 cut(s) 290
BstF5I GGATG 2 cut(s) 61, 103
BstH2I RGCGCY 1 cut(s) 64
BstHHI GCGC 1 cut(s) 63
BstKTI GATC 4 cut(s) 6, 154, 179, 252
BstMBI GATC 4 cut(s) 3, 151, 176, 249
BstMWI GCNNNNNNNGC 1 cut(s) 40
BstNSI RCATGY 2 cut(s) 95, 283
BstSFI CTRYAG 1 cut(s) 180
BstX2I RGATCY 2 cut(s) 151, 176
BstYI RGATCY 2 cut(s) 151, 176
BtsCI GGATG 2 cut(s) 61, 103
BtsI GCAGTG 1 cut(s) 255
BtsIMutI CAGTG 1 cut(s) 255
CfoI GCGC 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 79
CviAII CATG 2 cut(s) 92, 280
CviJI RGCY 2 cut(s) 34, 229
CviKI_1 RGCY 2 cut(s) 34, 229
DpnI GATC 4 cut(s) 5, 153, 178, 251
DpnII GATC 4 cut(s) 3, 151, 176, 249
Eco47I GGWCC 1 cut(s) 79
EcoRI GAATTC 1 cut(s) 130
FaeI CATG 2 cut(s) 95, 283
FaiI YATR 4 cut(s) 93, 122, 281, 298
FaqI GGGAC 1 cut(s) 102
FatI CATG 2 cut(s) 91, 279
FokI GGATG 2 cut(s) 68, 110
FspBI CTAG 1 cut(s) 35
GlaI GCGC 1 cut(s) 62
GsuI CTGGAG 1 cut(s) 125
HaeII RGCGCY 1 cut(s) 64
HhaI GCGC 1 cut(s) 63
Hin1II CATG 2 cut(s) 95, 283
Hin6I GCGC 1 cut(s) 61
HinP1I GCGC 1 cut(s) 61
HphI GGTGA 1 cut(s) 175
Hpy188I TCNGA 2 cut(s) 16, 189
Hpy188III TCNNGA 2 cut(s) 142, 232
HpyAV CCTTC 2 cut(s) 46, 280
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4IV ACGT 1 cut(s) 19
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 2 cut(s) 95, 283
HspAI GCGC 1 cut(s) 61
Kzo9I GATC 4 cut(s) 3, 151, 176, 249
LpnPI CCDG 4 cut(s) 140, 155, 203, 225
MaeI CTAG 1 cut(s) 35
MaeII ACGT 1 cut(s) 19
MalI GATC 4 cut(s) 5, 153, 178, 251
MboI GATC 4 cut(s) 3, 151, 176, 249
MboII GAAGA 1 cut(s) 207
MfeI CAATTG 1 cut(s) 83
MflI RGATCY 2 cut(s) 151, 176
MhlI GDGCHC 1 cut(s) 14
MluCI AATT 5 cut(s) 83, 102, 124, 130, 293
MnlI CCTC 4 cut(s) 42, 64, 125, 154
MslI CAYNNNNRTG 1 cut(s) 96
MunI CAATTG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 4 cut(s) 3, 151, 176, 249
NlaIII CATG 2 cut(s) 95, 283
NspI RCATGY 2 cut(s) 95, 283
NspV TTCGAA 1 cut(s) 290
PciI ACATGT 1 cut(s) 91
PscI ACATGT 1 cut(s) 91
PspPI GGNCC 1 cut(s) 79
PsuI RGATCY 2 cut(s) 151, 176
RseI CAYNNNNRTG 1 cut(s) 96
Sau3AI GATC 4 cut(s) 3, 151, 176, 249
Sau96I GGNCC 1 cut(s) 79
SduI GDGCHC 1 cut(s) 14
SetI ASST 6 cut(s) 22, 36, 117, 165, 231, 272
SfcI CTRYAG 1 cut(s) 180
SfuI TTCGAA 1 cut(s) 290
SinI GGWCC 1 cut(s) 79
SmiMI CAYNNNNRTG 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
Sse9I AATT 5 cut(s) 83, 102, 124, 130, 293
SspMI CTAG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 208
TaiI ACGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 290
TasI AATT 5 cut(s) 83, 102, 124, 130, 293
TscAI CASTG 1 cut(s) 262
TspDTI ATGAA 1 cut(s) 114
TspRI CASTG 1 cut(s) 262
VpaK11BI GGWCC 1 cut(s) 79
XapI RAATTY 2 cut(s) 124, 130
XceI RCATGY 2 cut(s) 95, 283
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.