Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0002384

Physical Location & Seq

Genomic Coordinates Reverse (-)

25818616 .. 25821419

Gene Structure 2804 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ31133

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

ATGGCATCCTTAAGCCCCTCAACATTCAACAAGGCTGTGTCATCTACCCCTTTCTCCGTTAAACCTGCTTTTATTAACTTTTTTGGTGGATTCCATGGAGGAGCTATAGCTTCTATTGCTGAGGCTGTGTTAGTAGCTACTGCAAGAACGGTTGTGGTTGAGGATAAGGAGCTTTTTCTAGGGGAACTGAGCATCTCTTACCTCTCTTCTGCTCCAAAGAATGTTGTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

4HBT

Protein Analysis

76

Amino Acids

7.89

Weight (kDa)

6.53

Isoelectric Point (pI)

35.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002384)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G61200
fragaria_vesca	FvH4_7g13460 FvH4_7g13460 FvH4_7g13461
malus_domestica	MD01G1049100.v1.1 MD07G1126000.v1.1
prunus_persica	Prupe.2G157800_v2.0.a1 Prupe.2G158100_v2.0.a1 Prupe.2G158100_v2.0.a1 Prupe.2G158100_v2.0.a1 Prupe.2G158100_v2.0.a1
pyrus_communis	pycom01g07430 pycom07g12050
rosa_chinensis	RchiOBHm_Chr1g0352831 RchiOBHm_Chr1g0352841 RchiOBHm_Chr5g0032131
rosa_laevigata	RLG00000028312 RLG00000028313
rosa_multiflora	Rmu_sc0000825.1_g000012 Rmu_sc0006445.1_g000014 Rmu_sc0006445.1_g000018 Rmu_sc0006445.1_g000019
rosa_roxburghii	Rroxscaffold_1G00026950 Rroxscaffold_4G00302290
rosa_rugosa	Rorug01G0231700 Rorug01G0231800
rosa_samantha	Rh1AG245000 Rh1AG245100 Rh1BG215700 Rh1CG077200 Rh1CG228800 Rh1CG228900 Rh1DG083700 Rh1DG241700 Rh1DG241800 Rh2AG359500 Rh3DG320000 Rh4DG118300 Rh5DG247100
rosa_wichuraiana	Rw0G013440 Rw1G013190 Rw5G025390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	73
AflII	CTTAAG	1 cut(s)	10
AgsI	TTSAA	1 cut(s)	28
AluBI	AGCT	4 cut(s)	104, 110, 137, 172
AluI	AGCT	4 cut(s)	104, 110, 137, 172
BbvCI	CCTCAGC	1 cut(s)	120
BfaI	CTAG	1 cut(s)	179
BfmI	CTRYAG	1 cut(s)	105
BfrI	CTTAAG	1 cut(s)	10
BfuAI	ACCTGC	1 cut(s)	73
BmsI	GCATC	2 cut(s)	14, 201
Bpu10I	CCTNAGC	1 cut(s)	120
BsaJI	CCNNGG	1 cut(s)	94
BseDI	CCNNGG	1 cut(s)	94
BseGI	GGATG	1 cut(s)	5
BseMII	CTCAG	2 cut(s)	111, 179
BseRI	GAGGAG	1 cut(s)	114
Bsp19I	CCATGG	1 cut(s)	94
BspCNI	CTCAG	2 cut(s)	112, 180
BspMI	ACCTGC	1 cut(s)	73
BspTI	CTTAAG	1 cut(s)	10
BssECI	CCNNGG	1 cut(s)	94
BssT1I	CCWWGG	1 cut(s)	94
Bst4CI	ACNGT	1 cut(s)	151
Bst6I	CTCTTC	1 cut(s)	211
BstAFI	CTTAAG	1 cut(s)	10
BstDEI	CTNAG	2 cut(s)	120, 188
BstDSI	CCRYGG	1 cut(s)	94
BstF5I	GGATG	1 cut(s)	5
BstMWI	GCNNNNNNNGC	1 cut(s)	116
BstSFI	CTRYAG	1 cut(s)	105
BtgI	CCRYGG	1 cut(s)	94
BtsCI	GGATG	1 cut(s)	5
BveI	ACCTGC	1 cut(s)	73
CviAII	CATG	1 cut(s)	95
CviJI	RGCY	7 cut(s)	15, 35, 104, 110, 125, 137, 172
CviKI_1	RGCY	7 cut(s)	15, 35, 104, 110, 125, 137, 172
DdeI	CTNAG	2 cut(s)	120, 188
Eam1104I	CTCTTC	1 cut(s)	211
EarI	CTCTTC	1 cut(s)	211
Eco130I	CCWWGG	1 cut(s)	94
EcoT14I	CCWWGG	1 cut(s)	94
ErhI	CCWWGG	1 cut(s)	94
FaeI	CATG	1 cut(s)	98
FaiI	YATR	2 cut(s)	96, 107
FatI	CATG	1 cut(s)	94
FspBI	CTAG	1 cut(s)	179
Hin1II	CATG	1 cut(s)	98
HinfI	GANTC	1 cut(s)	90
HpyCH4III	ACNGT	1 cut(s)	151
HpyCH4V	TGCA	1 cut(s)	143
HpyF10VI	GCNNNNNNNGC	1 cut(s)	116
HpyF3I	CTNAG	2 cut(s)	120, 188
Hsp92II	CATG	1 cut(s)	98
LmnI	GCTCC	3 cut(s)	101, 169, 217
LpnPI	CCDG	1 cut(s)	78
LweI	GCATC	2 cut(s)	14, 201
MaeI	CTAG	1 cut(s)	179
MboII	GAAGA	1 cut(s)	198
MnlI	CCTC	5 cut(s)	28, 92, 115, 154, 212
MseI	TTAA	3 cut(s)	11, 60, 75
MspCI	CTTAAG	1 cut(s)	10
MwoI	GCNNNNNNNGC	1 cut(s)	116
NcoI	CCATGG	1 cut(s)	94
NlaIII	CATG	1 cut(s)	98
PfeI	GAWTC	1 cut(s)	90
SaqAI	TTAA	3 cut(s)	11, 60, 75
SetI	ASST	6 cut(s)	67, 106, 112, 139, 174, 204
SfaNI	GCATC	2 cut(s)	14, 201
SfcI	CTRYAG	1 cut(s)	105
SgeI	CNNG	5 cut(s)	43, 77, 107, 156, 191
SmlI	CTYRAG	1 cut(s)	10
SmoI	CTYRAG	1 cut(s)	10
SspMI	CTAG	1 cut(s)	179
StyI	CCWWGG	1 cut(s)	94
TaaI	ACNGT	1 cut(s)	151
TfiI	GAWTC	1 cut(s)	90
Tru1I	TTAA	3 cut(s)	11, 60, 75
Tru9I	TTAA	3 cut(s)	11, 60, 75
TspGWI	ACGGA	1 cut(s)	46
Vha464I	CTTAAG	1 cut(s)	10
XspI	CTAG	1 cut(s)	179

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.