Rh1AG245100
ERF Family

Thioesterase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
45858346 .. 45859363
1018 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG245100.1

Sequence Viewer

Length: 150 bp
ATGGAGGCAGAGGTGATAGTTGATGGATCTGTAGTTCGGAGTGGAAGAAATCTTACTGTAATAGCACAGGAGTTTAAGCTCAAGAAAACTGGGAACTTGATCTACACTGCTCGTGCTACCTTCTATCACATGCCTGTTTCAAAATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.48

Weight (kDa)

9.69

Isoelectric Point (pI)

31.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 34
AgsI TTSAA 1 cut(s) 141
AloI GAACNNNNNNTCC 2 cut(s) 18, 50
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
AlwI GGATC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 25
BarI GAAGNNNNNNTAC 2 cut(s) 37, 69
BauI CACGAG 1 cut(s) 111
BccI CCATC 1 cut(s) 17
BfmI CTRYAG 1 cut(s) 30
BmrI ACTGGG 1 cut(s) 99
BmuI ACTGGG 1 cut(s) 99
BpuEI CTTGAG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 94
Bsp143I GATC 2 cut(s) 26, 99
BspPI GGATC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 94
BssMI GATC 2 cut(s) 26, 99
BssSI CACGAG 1 cut(s) 111
Bst2BI CACGAG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 58
BstKTI GATC 2 cut(s) 29, 102
BstMBI GATC 2 cut(s) 26, 99
BstNSI RCATGY 1 cut(s) 133
BstSFI CTRYAG 1 cut(s) 30
BstX2I RGATCY 1 cut(s) 26
BstYI RGATCY 1 cut(s) 26
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 1 cut(s) 105
CviAII CATG 1 cut(s) 130
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
DpnI GATC 2 cut(s) 28, 101
DpnII GATC 2 cut(s) 26, 99
FaeI CATG 1 cut(s) 133
FaiI YATR 2 cut(s) 131, 148
FatI CATG 1 cut(s) 129
FspEI CC 7 cut(s) 9, 22, 27, 53, 75, 76, 133
Hin1II CATG 1 cut(s) 133
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 58
Hsp92II CATG 1 cut(s) 133
Kzo9I GATC 2 cut(s) 26, 99
LpnPI CCDG 2 cut(s) 53, 75
MalI GATC 2 cut(s) 28, 101
MboI GATC 2 cut(s) 26, 99
MboII GAAGA 1 cut(s) 57
MflI RGATCY 1 cut(s) 26
MluCI AATT 1 cut(s) 143
MnlI CCTC 1 cut(s) 4
MseI TTAA 1 cut(s) 75
NdeII GATC 2 cut(s) 26, 99
NlaIII CATG 1 cut(s) 133
NspI RCATGY 1 cut(s) 133
PsrI GAACNNNNNNTAC 2 cut(s) 86, 118
PsuI RGATCY 1 cut(s) 26
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 2 cut(s) 26, 99
SetI ASST 3 cut(s) 15, 81, 122
SfcI CTRYAG 1 cut(s) 30
SgeI CNNG 8 cut(s) 80, 94, 102, 109, 123, 125, 142, 146
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 1 cut(s) 143
TaaI ACNGT 1 cut(s) 58
TasI AATT 1 cut(s) 143
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 112
TspRI CASTG 1 cut(s) 112
XceI RCATGY 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.