RchiOBHm_Chr4g0387271

Homocysteine s-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
2422066 .. 2422745
680 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGACTGCAAACAAACTAGAAGTAAAGGCAACAAGCAAACCAATAGTGATATACCCCAACAGTGCTGAGACCTATGATGGTCAGAGCAAGCAATGGGTGCCATCGAGGGGGTGGGTTAGAGTTTTTGGACATTGTCTTAGACCAGTGGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.65

Weight (kDa)

9.74

Isoelectric Point (pI)

53.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 107
Alw26I GTCTC 1 cut(s) 62
BanI GGYRCC 1 cut(s) 97
BccI CCATC 2 cut(s) 71, 109
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 99
BsaI GGTCTC 1 cut(s) 62
Bsc4I CCNNNNNNNGG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 143
Bse3DI GCAATG 1 cut(s) 98
BseLI CCNNNNNNNGG 1 cut(s) 107
BseMI GCAATG 1 cut(s) 98
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 143
BshNI GGYRCC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 62
Bso31I GGTCTC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 99
BspT107I GGYRCC 1 cut(s) 97
BspTNI GGTCTC 1 cut(s) 62
BsrDI GCAATG 1 cut(s) 98
BsrI ACTGG 1 cut(s) 143
Bst4CI ACNGT 1 cut(s) 62
BstAPI GCANNNNNTGC 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 66, 137
BstMAI GTCTC 1 cut(s) 62
BstMWI GCNNNNNNNGC 1 cut(s) 97
BtsIMutI CAGTG 2 cut(s) 67, 150
Cac8I GCNNGC 1 cut(s) 89
DdeI CTNAG 2 cut(s) 66, 137
Eco31I GGTCTC 1 cut(s) 62
FaiI YATR 2 cut(s) 52, 75
FspBI CTAG 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 84
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 8
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 2 cut(s) 66, 137
MaeI CTAG 1 cut(s) 17
MnlI CCTC 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 99
PflFI GACNNNGTC 1 cut(s) 132
PspN4I GGNNCC 1 cut(s) 99
PsyI GACNNNGTC 1 cut(s) 132
SetI ASST 1 cut(s) 74
SgeI CNNG 4 cut(s) 29, 45, 100, 117
SspMI CTAG 1 cut(s) 17
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 104
TscAI CASTG 2 cut(s) 67, 150
TspRI CASTG 2 cut(s) 67, 150
Tth111I GACNNNGTC 1 cut(s) 132
XcmI CCANNNNNNNNNTGG 1 cut(s) 108
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.