RchiOBHm_Chr7g0204331

Homocysteine s-methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0002729
Physical Location & Seq
Reverse (-)
22013293 .. 22013688
396 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18288

Sequence Viewer

Length: 162 bp
ATGTGCTTTCCATTGCAGCCATCGGGCGGGCGGGTTAATGAAGAGTTTGCAGAAACAGTCATGGAGAAGTGGCGTGAGGCTGGGGCTTCCCTGTTTGGAGGCTGCTGCAGAACTACTCCAAATACCATAAGGGCAATATCTAAGGCTCTTTCTAGTTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00270 ko01100 ko01110 map00270 map01100 map01110
Pfam Domains
Protein Families
S-methyl_trans

Protein Analysis

53

Amino Acids

5.78

Weight (kDa)

7.72

Isoelectric Point (pI)

38.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S-methyl_trans PF02574 13 - 50 4.2e-10 Homocysteine S-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 27, 31
AfiI CCNNNNNNNGG 1 cut(s) 26
ApeKI GCWGC 3 cut(s) 16, 102, 105
BbvI GCAGC 3 cut(s) 28, 89, 92
BccI CCATC 1 cut(s) 28
BfaI CTAG 1 cut(s) 153
BfmI CTRYAG 1 cut(s) 106
BisI GCNGC 3 cut(s) 17, 103, 106
BlsI GCNGC 3 cut(s) 18, 104, 107
Bsc4I CCNNNNNNNGG 1 cut(s) 26
Bse3DI GCAATG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMI GCAATG 1 cut(s) 11
BseXI GCAGC 3 cut(s) 28, 89, 92
BseYI CCCAGC 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 26
BspACI CCGC 2 cut(s) 27, 31
BspMAI CTGCAG 1 cut(s) 110
BsrDI GCAATG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 36
BstC8I GCNNGC 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 141
BstSFI CTRYAG 1 cut(s) 106
BstV1I GCAGC 3 cut(s) 28, 89, 92
Cac8I GCNNGC 1 cut(s) 29
CviAII CATG 1 cut(s) 61
CviJI RGCY 5 cut(s) 19, 80, 86, 102, 146
CviKI_1 RGCY 5 cut(s) 19, 80, 86, 102, 146
DdeI CTNAG 1 cut(s) 141
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
FaeI CATG 1 cut(s) 64
FaiI YATR 2 cut(s) 62, 128
FatI CATG 1 cut(s) 60
FauI CCCGC 2 cut(s) 20, 24
Fnu4HI GCNGC 3 cut(s) 17, 103, 106
Fsp4HI GCNGC 3 cut(s) 17, 103, 106
FspBI CTAG 1 cut(s) 153
GluI GCNGC 3 cut(s) 17, 103, 106
GsaI CCCAGC 1 cut(s) 84
Hin1II CATG 1 cut(s) 64
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 3 cut(s) 16, 50, 108
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 1 cut(s) 64
LpnPI CCDG 2 cut(s) 66, 104
Lsp1109I GCAGC 3 cut(s) 28, 89, 92
MaeI CTAG 1 cut(s) 153
MboII GAAGA 1 cut(s) 53
MnlI CCTC 2 cut(s) 70, 92
MseI TTAA 1 cut(s) 36
NlaIII CATG 1 cut(s) 64
PkrI GCNGC 3 cut(s) 18, 104, 107
PspFI CCCAGC 1 cut(s) 80
PstI CTGCAG 1 cut(s) 110
SaqAI TTAA 1 cut(s) 36
SatI GCNGC 3 cut(s) 17, 103, 106
SfcI CTRYAG 1 cut(s) 106
SgeI CNNG 7 cut(s) 36, 40, 44, 73, 86, 93, 103
SsiI CCGC 2 cut(s) 27, 31
SspMI CTAG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 58
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TseI GCWGC 3 cut(s) 16, 102, 105
TspDTI ATGAA 1 cut(s) 54
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.