Rh1DG032500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
4822844 .. 4826595
3752 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG032500.1

Sequence Viewer

Length: 234 bp
ATGGTCCAACCACTTGGAGCCAAATCACTTGGGAACTCTAAACTTTTCACTTGGAATGGTTACAGATTCCGGTCAAGTCAAGTACATGCTGATCTAACTGAATTTGAGAGGACTAAAAATAAGATAAAAGCAAATCTCCCTAGCCAGTTCCTTGATCAGATGGCCTTAAATCGAAACTGGTCATCTACTGCTACATTGATGTGGGGACTTGGATTATGCCCGGAAGCTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.7

Weight (kDa)

9.74

Isoelectric Point (pI)

29.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 101
AfaI GTAC 1 cut(s) 84
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AoxI GGCC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 101
AspS9I GGNCC 1 cut(s) 4
AsuC2I CCSGG 1 cut(s) 221
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 154
BclI TGATCA 1 cut(s) 154
BcnI CCSGG 1 cut(s) 221
BfaI CTAG 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 221
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 221
BpuMI CCSGG 1 cut(s) 221
BsaWI WCCGGW 1 cut(s) 69
Bse1I ACTGG 2 cut(s) 145, 182
BseNI ACTGG 2 cut(s) 145, 182
BshFI GGCC 1 cut(s) 164
BsiSI CCGG 2 cut(s) 70, 221
BslFI GGGAC 1 cut(s) 219
BsmFI GGGAC 1 cut(s) 219
BsnI GGCC 1 cut(s) 164
Bsp143I GATC 2 cut(s) 91, 154
BspANI GGCC 1 cut(s) 164
BspLI GGNNCC 1 cut(s) 19
BsrI ACTGG 2 cut(s) 145, 182
BssMI GATC 2 cut(s) 91, 154
BstKTI GATC 2 cut(s) 94, 157
BstMBI GATC 2 cut(s) 91, 154
BstNSI RCATGY 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 219
BstXI CCANNNNNNTGG 1 cut(s) 14
BsuRI GGCC 1 cut(s) 164
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 83
CviAII CATG 1 cut(s) 86
CviJI RGCY 4 cut(s) 20, 144, 164, 227
CviKI_1 RGCY 4 cut(s) 20, 144, 164, 227
CviQI GTAC 1 cut(s) 83
DpnI GATC 2 cut(s) 93, 156
DpnII GATC 2 cut(s) 91, 154
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 1 cut(s) 89
FaiI YATR 2 cut(s) 87, 217
FaqI GGGAC 1 cut(s) 219
FatI CATG 1 cut(s) 85
FbaI TGATCA 1 cut(s) 154
FspBI CTAG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 164
HapII CCGG 2 cut(s) 70, 221
Hin1II CATG 1 cut(s) 89
HinfI GANTC 1 cut(s) 66
HpaII CCGG 2 cut(s) 70, 221
Hpy188I TCNGA 1 cut(s) 159
Hsp92II CATG 1 cut(s) 89
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 2 cut(s) 91, 154
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 3 cut(s) 83, 158, 163
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 59
MalI GATC 2 cut(s) 93, 156
MboI GATC 2 cut(s) 91, 154
MluCI AATT 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 1 cut(s) 102
MseI TTAA 1 cut(s) 167
MslI CAYNNNNRTG 1 cut(s) 199
MspI CCGG 2 cut(s) 70, 221
MspR9I CCNGG 1 cut(s) 221
NciI CCSGG 1 cut(s) 221
NdeII GATC 2 cut(s) 91, 154
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 19
NspI RCATGY 1 cut(s) 89
PfeI GAWTC 1 cut(s) 66
PspN4I GGNNCC 1 cut(s) 19
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 199
SaqAI TTAA 1 cut(s) 167
Sau3AI GATC 2 cut(s) 91, 154
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 221
SetI ASST 1 cut(s) 229
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 199
Sse9I AATT 1 cut(s) 101
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 219
TaqI TCGA 1 cut(s) 172
TasI AATT 1 cut(s) 101
TatI WGTACW 1 cut(s) 82
TfiI GAWTC 1 cut(s) 66
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 101
XceI RCATGY 1 cut(s) 89
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.