RchiOBHm_Chr4g0386691

Homocysteine s-methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0002729
Physical Location & Seq
Reverse (-)
2140609 .. 2141137
529 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36004

Sequence Viewer

Length: 237 bp
ATGTATAATCCTCTTAGAATAAATACCTTTCCTTTTTCATTGTTTTGTAACTTAGAGGATGTATTAAAACTATTCAGTTTCAGATTAATAGTCAATGGGGGGCAAGTCTCCTTCTATATGAATGCACAGTGGCGTGAGGCTGGGGCTTCCCTGTTCGGAGGCTGCTGCAGAACAACTCCAAATACCATAAAGGCAATATCTAAGGCTCTTTCTAACAAGCTGGTCCTCTGCAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00270 ko01100 ko01110 map00270 map01100 map01110
Pfam Domains
Protein Families
S-methyl_trans

Protein Analysis

78

Amino Acids

8.73

Weight (kDa)

9.38

Isoelectric Point (pI)

28.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S-methyl_trans PF02574 41 - 70 1.4e-08 Homocysteine S-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 220
AluI AGCT 1 cut(s) 220
Alw26I GTCTC 1 cut(s) 112
ApeKI GCWGC 2 cut(s) 162, 165
AseI ATTAAT 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 223
AvaII GGWCC 1 cut(s) 223
BbvI GCAGC 2 cut(s) 149, 152
BcoDI GTCTC 1 cut(s) 112
BfmI CTRYAG 2 cut(s) 166, 229
BisI GCNGC 2 cut(s) 163, 166
BlsI GCNGC 2 cut(s) 164, 167
Bme18I GGWCC 1 cut(s) 223
BmgT120I GGNCC 1 cut(s) 223
BseGI GGATG 1 cut(s) 64
BseXI GCAGC 2 cut(s) 149, 152
BseYI CCCAGC 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 112
BsmI GAATGC 1 cut(s) 127
BspMAI CTGCAG 2 cut(s) 170, 233
Bst4CI ACNGT 1 cut(s) 129
BstDEI CTNAG 3 cut(s) 14, 52, 201
BstF5I GGATG 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 112
BstSFI CTRYAG 2 cut(s) 166, 229
BstV1I GCAGC 2 cut(s) 149, 152
BtsCI GGATG 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 223
CviJI RGCY 5 cut(s) 140, 146, 162, 206, 220
CviKI_1 RGCY 5 cut(s) 140, 146, 162, 206, 220
DdeI CTNAG 3 cut(s) 14, 52, 201
Eco47I GGWCC 1 cut(s) 223
FaiI YATR 4 cut(s) 6, 117, 119, 188
Fnu4HI GCNGC 2 cut(s) 163, 166
FokI GGATG 1 cut(s) 71
Fsp4HI GCNGC 2 cut(s) 163, 166
GluI GCNGC 2 cut(s) 163, 166
GsaI CCCAGC 1 cut(s) 144
Hpy188I TCNGA 2 cut(s) 83, 158
HpyAV CCTTC 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 129
HpyCH4V TGCA 3 cut(s) 125, 168, 231
HpyF3I CTNAG 3 cut(s) 14, 52, 201
LpnPI CCDG 3 cut(s) 126, 164, 206
Lsp1109I GCAGC 2 cut(s) 149, 152
MaeIII GTNAC 1 cut(s) 47
MnlI CCTC 5 cut(s) 21, 49, 130, 152, 236
MseI TTAA 3 cut(s) 65, 86, 235
Mva1269I GAATGC 1 cut(s) 127
PctI GAATGC 1 cut(s) 127
PkrI GCNGC 2 cut(s) 164, 167
PshBI ATTAAT 1 cut(s) 86
PspFI CCCAGC 1 cut(s) 140
PspPI GGNCC 1 cut(s) 223
PstI CTGCAG 2 cut(s) 170, 233
SaqAI TTAA 3 cut(s) 65, 86, 235
SatI GCNGC 2 cut(s) 163, 166
Sau96I GGNCC 1 cut(s) 223
SetI ASST 2 cut(s) 29, 222
SfcI CTRYAG 2 cut(s) 166, 229
SgeI CNNG 6 cut(s) 116, 146, 153, 163, 229, 233
SinI GGWCC 1 cut(s) 223
TaaI ACNGT 1 cut(s) 129
Tru1I TTAA 3 cut(s) 65, 86, 235
Tru9I TTAA 3 cut(s) 65, 86, 235
TscAI CASTG 1 cut(s) 134
TseI GCWGC 2 cut(s) 162, 165
TspDTI ATGAA 2 cut(s) 27, 134
TspRI CASTG 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 223
VspI ATTAAT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.