Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0002729

Physical Location & Seq

Genomic Coordinates Reverse (-)

1372863 .. 1375091

Gene Structure 2229 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00334040.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 216 bp

ATGATCGCAAATGAGCTAGAAGCAAAGTGGGAAATATATACTTTCACTTGGAATGGTTGCAGATTCAAGCAAAATCGGGTACATGCCGATCTGTATGAAGTTGAGACAACTGCAAATGAACTAGAAGGAAAGGTAACAAGCAAACTAATAGTGATATACCCCAACAGTGGTGAGACCTATGATGGCCAGAGCAGGCAAATGGGTGTCATCAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00270 ko01100 ko01110 map00270 map01100 map01110

Pfam Domains

Protein Families

S-methyl_trans

Protein Analysis

71

Amino Acids

8.22

Weight (kDa)

5.27

Isoelectric Point (pI)

18.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002729)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22740
fragaria_vesca	FvH4_4g00800 FvH4_4g00800 FvH4_4g00800
malus_domestica	MD00G1181400.v1.1
prunus_persica	Prupe.1G018900_v2.0.a1 Prupe.1G018900_v2.0.a1 Prupe.1G018900_v2.0.a1
pyrus_communis	pycom13g17110
rosa_chinensis	RchiOBHm_Chr4g0386691 RchiOBHm_Chr4g0386711 RchiOBHm_Chr4g0386841 RchiOBHm_Chr4g0386961 RchiOBHm_Chr4g0386981 RchiOBHm_Chr4g0387271 RchiOBHm_Chr4g0387331 RchiOBHm_Chr4g0387351 RchiOBHm_Chr4g0387451 RchiOBHm_Chr7g0204331
rosa_multiflora	Rmu_sc0000013.1_g000020 Rmu_sc0000013.1_g000025 Rmu_sc0001317.1_g000013 Rmu_sc0001395.1_g000003 Rmu_sc0001942.1_g000050 Rmu_sc0006571.1_g000023 Rmu_sc0006648.1_g000005 Rmu_sc0027325.1_g000001
rosa_roxburghii	Rroxscaffold_5G00334040 Rroxscaffold_5G00334070
rosa_rugosa	Rorug03G0308800 Rorug03G0309400 Rorug03G0323000
rosa_samantha	Rh1DG032500 Rh4AG015400 Rh4DG011100
rosa_wichuraiana	Rw4G000880 Rw4G000920 Rw4G000950 Rw4G001260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	184
AfaI	GTAC	1 cut(s)	81
AfiI	CCNNNNNNNGG	1 cut(s)	167
AgsI	TTSAA	1 cut(s)	67
AluBI	AGCT	1 cut(s)	16
AluI	AGCT	1 cut(s)	16
Alw26I	GTCTC	2 cut(s)	98, 167
AoxI	GGCC	1 cut(s)	184
AsuHPI	GGTGA	1 cut(s)	182
BalI	TGGCCA	1 cut(s)	186
BccI	CCATC	1 cut(s)	176
BcoDI	GTCTC	2 cut(s)	98, 167
BfaI	CTAG	2 cut(s)	17, 122
BsaI	GGTCTC	1 cut(s)	167
Bsc4I	CCNNNNNNNGG	1 cut(s)	167
BseLI	CCNNNNNNNGG	1 cut(s)	167
BshFI	GGCC	1 cut(s)	186
BslI	CCNNNNNNNGG	1 cut(s)	167
BsmAI	GTCTC	2 cut(s)	98, 167
BsnI	GGCC	1 cut(s)	186
Bso31I	GGTCTC	1 cut(s)	167
Bsp143I	GATC	2 cut(s)	3, 88
BspANI	GGCC	1 cut(s)	186
BspTNI	GGTCTC	1 cut(s)	167
BssMI	GATC	2 cut(s)	3, 88
Bst4CI	ACNGT	1 cut(s)	167
BstC8I	GCNNGC	1 cut(s)	194
BstKTI	GATC	2 cut(s)	6, 91
BstMAI	GTCTC	2 cut(s)	98, 167
BstMBI	GATC	2 cut(s)	3, 88
BstNSI	RCATGY	1 cut(s)	86
BsuRI	GGCC	1 cut(s)	186
BtsIMutI	CAGTG	1 cut(s)	172
Cac8I	GCNNGC	1 cut(s)	194
Csp6I	GTAC	1 cut(s)	80
CviAII	CATG	1 cut(s)	83
CviJI	RGCY	2 cut(s)	16, 186
CviKI_1	RGCY	2 cut(s)	16, 186
CviQI	GTAC	1 cut(s)	80
DpnI	GATC	2 cut(s)	5, 90
DpnII	GATC	2 cut(s)	3, 88
EaeI	YGGCCR	1 cut(s)	184
Eco31I	GGTCTC	1 cut(s)	167
FaeI	CATG	1 cut(s)	86
FaiI	YATR	6 cut(s)	37, 39, 84, 96, 157, 180
FatI	CATG	1 cut(s)	82
FspBI	CTAG	2 cut(s)	17, 122
HaeIII	GGCC	1 cut(s)	186
Hin1II	CATG	1 cut(s)	86
HinfI	GANTC	1 cut(s)	63
HphI	GGTGA	1 cut(s)	182
HpyAV	CCTTC	1 cut(s)	119
HpyCH4III	ACNGT	1 cut(s)	167
HpyCH4V	TGCA	2 cut(s)	60, 113
Hsp92II	CATG	1 cut(s)	86
Kzo9I	GATC	2 cut(s)	3, 88
LpnPI	CCDG	2 cut(s)	178, 200
MaeI	CTAG	2 cut(s)	17, 122
MaeIII	GTNAC	1 cut(s)	133
MalI	GATC	2 cut(s)	5, 90
MboI	GATC	2 cut(s)	3, 88
MlsI	TGGCCA	1 cut(s)	186
MluNI	TGGCCA	1 cut(s)	186
Mox20I	TGGCCA	1 cut(s)	186
MscI	TGGCCA	1 cut(s)	186
Msp20I	TGGCCA	1 cut(s)	186
NdeII	GATC	2 cut(s)	3, 88
NlaIII	CATG	1 cut(s)	86
NspI	RCATGY	1 cut(s)	86
PfeI	GAWTC	1 cut(s)	63
RsaI	GTAC	1 cut(s)	81
RsaNI	GTAC	1 cut(s)	80
Sau3AI	GATC	2 cut(s)	3, 88
SetI	ASST	3 cut(s)	18, 135, 179
SgeI	CNNG	9 cut(s)	29, 60, 79, 89, 95, 134, 150, 199, 205
SspMI	CTAG	2 cut(s)	17, 122
TaaI	ACNGT	1 cut(s)	167
TfiI	GAWTC	1 cut(s)	63
TscAI	CASTG	1 cut(s)	172
TspDTI	ATGAA	2 cut(s)	111, 132
TspRI	CASTG	1 cut(s)	172
XceI	RCATGY	1 cut(s)	86
XspI	CTAG	2 cut(s)	17, 122

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.