RchiOBHm_Chr2g0104371

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
15742191 .. 15746654
4464 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGGCTGCTGTGCTTGCTGGTGGAGCAGTGTTAGGGACAGTATTTTCAGAGCTGTACAAGGGCGTTCAGACACTGATCAGAACATCTAAGCATTTTAAAGACCTTGCCAAAAACATTAAATTGAAATTAGAATGCTTGCTACCACTGATCAAGCAGATTGAGGAACAAAACATGGAACTCGGTCGCTCGAACCAGTGTACAGAAAAATTTAAAATAGAAATAGTCGAGGGCCTAGAGCTTGTCCAAAATTGCTGTAAGGTTGGTCCATTGGAAATATCCAAACAGAGGAATTACATCAGAGAACTTCGTGAGTTGGATGGTTCACTTAAGAACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.7

Weight (kDa)

8.7

Isoelectric Point (pI)

40.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPW8 PF05659 5 - 111 7.6e-18 Arabidopsis broad-spectrum mildew resistance protein RPW8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 206
AfaI GTAC 2 cut(s) 56, 199
AfiI CCNNNNNNNGG 1 cut(s) 285
AflII CTTAAG 1 cut(s) 326
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 2 cut(s) 52, 238
AluI AGCT 2 cut(s) 52, 238
AlwNI CAGNNNCTG 1 cut(s) 73
AoxI GGCC 1 cut(s) 229
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 206
AspS9I GGNCC 2 cut(s) 229, 263
AvaII GGWCC 1 cut(s) 263
BccI CCATC 1 cut(s) 311
BclI TGATCA 2 cut(s) 75, 147
BfaI CTAG 1 cut(s) 233
BfrI CTTAAG 1 cut(s) 326
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme18I GGWCC 1 cut(s) 263
BmgT120I GGNCC 2 cut(s) 229, 263
Bsc4I CCNNNNNNNGG 1 cut(s) 285
Bse1I ACTGG 2 cut(s) 193, 338
BseGI GGATG 1 cut(s) 322
BseLI CCNNNNNNNGG 1 cut(s) 285
BseNI ACTGG 2 cut(s) 193, 338
Bsh1285I CGRYCG 1 cut(s) 184
BshFI GGCC 1 cut(s) 231
BsiEI CGRYCG 1 cut(s) 184
BslFI GGGAC 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 285
BsmFI GGGAC 1 cut(s) 49
BsmI GAATGC 1 cut(s) 137
BsnI GGCC 1 cut(s) 231
Bsp1407I TGTACA 2 cut(s) 54, 197
Bsp143I GATC 2 cut(s) 75, 147
BspANI GGCC 1 cut(s) 231
BspTI CTTAAG 1 cut(s) 326
BsrGI TGTACA 2 cut(s) 54, 197
BsrI ACTGG 2 cut(s) 193, 338
BssMI GATC 2 cut(s) 75, 147
Bst4CI ACNGT 1 cut(s) 40
BstAFI CTTAAG 1 cut(s) 326
BstAUI TGTACA 2 cut(s) 54, 197
BstC8I GCNNGC 2 cut(s) 15, 137
BstDEI CTNAG 1 cut(s) 87
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 2 cut(s) 78, 150
BstMBI GATC 2 cut(s) 75, 147
BstMCI CGRYCG 1 cut(s) 184
BstMWI GCNNNNNNNGC 2 cut(s) 14, 23
BsuRI GGCC 1 cut(s) 231
BtsCI GGATG 1 cut(s) 322
BtsI GCAGTG 1 cut(s) 33
BtsIMutI CAGTG 4 cut(s) 33, 71, 143, 200
Cac8I GCNNGC 2 cut(s) 15, 137
CaiI CAGNNNCTG 1 cut(s) 73
Cfr13I GGNCC 2 cut(s) 229, 263
Csp6I GTAC 2 cut(s) 55, 198
CviAII CATG 1 cut(s) 172
CviJI RGCY 4 cut(s) 5, 52, 231, 238
CviKI_1 RGCY 4 cut(s) 5, 52, 231, 238
CviQI GTAC 2 cut(s) 55, 198
DdeI CTNAG 1 cut(s) 87
DpnI GATC 2 cut(s) 77, 149
DpnII GATC 2 cut(s) 75, 147
DraI TTTAAA 2 cut(s) 97, 211
Eco47I GGWCC 1 cut(s) 263
EcoO109I RGGNCCY 1 cut(s) 229
FaeI CATG 1 cut(s) 175
FaiI YATR 1 cut(s) 173
FaqI GGGAC 1 cut(s) 49
FatI CATG 1 cut(s) 171
FbaI TGATCA 2 cut(s) 75, 147
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 329
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 233
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 231
Hin1II CATG 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 198, 323
Hpy188I TCNGA 4 cut(s) 49, 69, 80, 299
Hpy188III TCNNGA 1 cut(s) 308
Hpy8I GTNNAC 2 cut(s) 198, 323
HpyCH4III ACNGT 1 cut(s) 40
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 23
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 1 cut(s) 175
Ksp22I TGATCA 2 cut(s) 75, 147
Kzo9I GATC 2 cut(s) 75, 147
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 3 cut(s) 3, 206, 319
MaeI CTAG 1 cut(s) 233
MalI GATC 2 cut(s) 77, 149
MboI GATC 2 cut(s) 75, 147
MluCI AATT 5 cut(s) 119, 125, 206, 247, 289
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 3 cut(s) 154, 220, 279
MseI TTAA 4 cut(s) 96, 117, 210, 327
MspCI CTTAAG 1 cut(s) 326
Mva1269I GAATGC 1 cut(s) 137
MwoI GCNNNNNNNGC 2 cut(s) 14, 23
NdeII GATC 2 cut(s) 75, 147
NlaIII CATG 1 cut(s) 175
PctI GAATGC 1 cut(s) 137
PkrI GCNGC 1 cut(s) 7
PspPI GGNCC 2 cut(s) 229, 263
PstNI CAGNNNCTG 1 cut(s) 73
RsaI GTAC 2 cut(s) 56, 199
RsaNI GTAC 2 cut(s) 55, 198
SaqAI TTAA 4 cut(s) 96, 117, 210, 327
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 2 cut(s) 75, 147
Sau96I GGNCC 2 cut(s) 229, 263
SetI ASST 4 cut(s) 54, 105, 240, 261
SinI GGWCC 1 cut(s) 263
SmlI CTYRAG 1 cut(s) 326
SmoI CTYRAG 1 cut(s) 326
Sse9I AATT 5 cut(s) 119, 125, 206, 247, 289
SspMI CTAG 1 cut(s) 233
TaaI ACNGT 1 cut(s) 40
TaqI TCGA 2 cut(s) 188, 225
TaqII GACCGA 1 cut(s) 170
TasI AATT 5 cut(s) 119, 125, 206, 247, 289
TatI WGTACW 2 cut(s) 54, 197
Tru1I TTAA 4 cut(s) 96, 117, 210, 327
Tru9I TTAA 4 cut(s) 96, 117, 210, 327
TscAI CASTG 4 cut(s) 33, 78, 150, 200
TseI GCWGC 1 cut(s) 5
TspRI CASTG 4 cut(s) 33, 78, 150, 200
Vha464I CTTAAG 1 cut(s) 326
VpaK11BI GGWCC 1 cut(s) 263
XapI RAATTY 1 cut(s) 206
XspI CTAG 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.