Rh7BG356200
WRKY Family

WRKY Transcription Factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
37408282 .. 37408548
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG356200.1

Sequence Viewer

Length: 267 bp
ATGGCCCTAGTGGAAGGGGCTGCTTTAGGAACTCTATTTGGAATGATGTATGATTTGGTTAAGGCAGCAATTGGCAAGAGTGTAGAGTTTAAACCCCTCCTAAGAGCCCCAAAATCCACACTAGAGTCTTTACAACCACAGATTATCCAACAGATAGGAGTGCAAAATGTTGCATTAGGTCTCCCAAACCACGAAATAGAAACTCTTGAAAGACAAATGCTGGAAGGCCTAAATCTCATTCAAGAGCTGTCGAATGCCCGAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.63

Weight (kDa)

5.25

Isoelectric Point (pI)

41.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPW8 PF05659 3 - 85 1.3e-11 Arabidopsis broad-spectrum mildew resistance protein RPW8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 209, 242
AluBI AGCT 1 cut(s) 247
AluI AGCT 1 cut(s) 247
Alw26I GTCTC 1 cut(s) 185
AoxI GGCC 2 cut(s) 3, 226
ApeKI GCWGC 2 cut(s) 20, 65
AspS9I GGNCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 109
BbvI GCAGC 2 cut(s) 7, 77
BcoDI GTCTC 1 cut(s) 185
BfaI CTAG 2 cut(s) 8, 122
BisI GCNGC 2 cut(s) 21, 66
BlsI GCNGC 2 cut(s) 22, 67
BmgT120I GGNCC 1 cut(s) 4
BsaI GGTCTC 1 cut(s) 185
BseXI GCAGC 2 cut(s) 7, 77
BshFI GGCC 2 cut(s) 5, 228
BsmAI GTCTC 1 cut(s) 185
BsmI GAATGC 1 cut(s) 259
BsnI GGCC 2 cut(s) 5, 228
Bso31I GGTCTC 1 cut(s) 185
Bsp1286I GDGCHC 1 cut(s) 109
BspANI GGCC 2 cut(s) 5, 228
BspTNI GGTCTC 1 cut(s) 185
BstDEI CTNAG 1 cut(s) 101
BstMAI GTCTC 1 cut(s) 185
BstV1I GCAGC 2 cut(s) 7, 77
BsuRI GGCC 2 cut(s) 5, 228
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 5 cut(s) 5, 20, 107, 228, 247
CviKI_1 RGCY 5 cut(s) 5, 20, 107, 228, 247
DdeI CTNAG 1 cut(s) 101
DraI TTTAAA 1 cut(s) 91
Eco147I AGGCCT 1 cut(s) 228
Eco24I GRGCYC 1 cut(s) 109
Eco31I GGTCTC 1 cut(s) 185
EcoT38I GRGCYC 1 cut(s) 109
FaiI YATR 1 cut(s) 51
Fnu4HI GCNGC 2 cut(s) 21, 66
FriOI GRGCYC 1 cut(s) 109
Fsp4HI GCNGC 2 cut(s) 21, 66
FspBI CTAG 2 cut(s) 8, 122
GluI GCNGC 2 cut(s) 21, 66
HaeIII GGCC 2 cut(s) 5, 228
HinfI GANTC 1 cut(s) 125
Hpy188III TCNNGA 2 cut(s) 206, 242
HpyAV CCTTC 2 cut(s) 8, 218
HpyCH4V TGCA 2 cut(s) 163, 173
HpyF3I CTNAG 1 cut(s) 101
LpnPI CCDG 1 cut(s) 206
Lsp1109I GCAGC 2 cut(s) 7, 77
MaeI CTAG 2 cut(s) 8, 122
MfeI CAATTG 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 1 cut(s) 69
MlyI GAGTC 1 cut(s) 134
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 1 cut(s) 107
MseI TTAA 2 cut(s) 60, 90
MssI GTTTAAAC 1 cut(s) 91
MunI CAATTG 1 cut(s) 69
Mva1269I GAATGC 1 cut(s) 259
PceI AGGCCT 1 cut(s) 228
PctI GAATGC 1 cut(s) 259
PkrI GCNGC 2 cut(s) 22, 67
PleI GAGTC 1 cut(s) 133
PmeI GTTTAAAC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 133
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 60, 90
SatI GCNGC 2 cut(s) 21, 66
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 134
SduI GDGCHC 1 cut(s) 109
SetI ASST 2 cut(s) 181, 249
SgeI CNNG 7 cut(s) 20, 88, 134, 203, 218, 233, 254
Sse9I AATT 1 cut(s) 69
SseBI AGGCCT 1 cut(s) 228
SspMI CTAG 2 cut(s) 8, 122
StuI AGGCCT 1 cut(s) 228
TaqI TCGA 1 cut(s) 251
TasI AATT 1 cut(s) 69
Tru1I TTAA 2 cut(s) 60, 90
Tru9I TTAA 2 cut(s) 60, 90
TseI GCWGC 2 cut(s) 20, 65
XspI CTAG 2 cut(s) 8, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.