RchiOBHm_Chr2g0113271

DNA-directed primase polymerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
25459469 .. 25462127
2659 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGAAGTCTGAAGAGGAGATGTTCATGGCGTCTTTGATCTGCAATTTGGAAGTTGATTGTGGGAAGCTTCTAGTCTGCAAATCTGATCTTGATTGTATAAAGACCCTGCATTTTGATACACAGAGGTCAACCCTAGTTTTGGAAAATCTTACAGTTGGCCCCAAGAATTTGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.56

Weight (kDa)

5.11

Isoelectric Point (pI)

22.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 166
AcuI CTGAAG 1 cut(s) 30
AcyI GRCGYC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 139
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AoxI GGCC 1 cut(s) 157
ApoI RAATTY 1 cut(s) 166
AspS9I GGNCC 1 cut(s) 158
BfaI CTAG 2 cut(s) 71, 134
BmgT120I GGNCC 1 cut(s) 158
BmiI GGNNCC 1 cut(s) 160
BsaHI GRCGYC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 139
BseRI GAGGAG 1 cut(s) 29
BshFI GGCC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 139
BsnI GGCC 1 cut(s) 159
Bsp143I GATC 2 cut(s) 36, 85
BspANI GGCC 1 cut(s) 159
BspLI GGNNCC 1 cut(s) 160
BssMI GATC 2 cut(s) 36, 85
BssNI GRCGYC 1 cut(s) 29
Bst4CI ACNGT 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 6
BstACI GRCGYC 1 cut(s) 29
BstKTI GATC 2 cut(s) 39, 88
BstMBI GATC 2 cut(s) 36, 85
BsuRI GGCC 1 cut(s) 159
Cfr13I GGNCC 1 cut(s) 158
CseI GACGC 1 cut(s) 18
CviAII CATG 1 cut(s) 25
CviJI RGCY 2 cut(s) 67, 159
CviKI_1 RGCY 2 cut(s) 67, 159
DpnI GATC 2 cut(s) 38, 87
DpnII GATC 2 cut(s) 36, 85
Eam1104I CTCTTC 1 cut(s) 6
EarI CTCTTC 1 cut(s) 6
Eco57I CTGAAG 1 cut(s) 30
FaeI CATG 1 cut(s) 28
FaiI YATR 2 cut(s) 26, 98
FatI CATG 1 cut(s) 24
FspBI CTAG 2 cut(s) 71, 134
HaeIII GGCC 1 cut(s) 159
HgaI GACGC 1 cut(s) 18
Hin1I GRCGYC 1 cut(s) 29
Hin1II CATG 1 cut(s) 28
HincII GTYRAC 1 cut(s) 129
HindII GTYRAC 1 cut(s) 129
HindIII AAGCTT 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 10, 85
Hpy188III TCNNGA 1 cut(s) 89
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 4 cut(s) 42, 78, 109, 172
Hsp92I GRCGYC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 28
Kzo9I GATC 2 cut(s) 36, 85
LpnPI CCDG 1 cut(s) 119
MaeI CTAG 2 cut(s) 71, 134
MalI GATC 2 cut(s) 38, 87
MboI GATC 2 cut(s) 36, 85
MboII GAAGA 1 cut(s) 23
MluCI AATT 2 cut(s) 43, 166
MnlI CCTC 2 cut(s) 7, 117
NdeII GATC 2 cut(s) 36, 85
NlaIII CATG 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 160
PspN4I GGNNCC 1 cut(s) 160
PspPI GGNCC 1 cut(s) 158
Sau3AI GATC 2 cut(s) 36, 85
Sau96I GGNCC 1 cut(s) 158
SetI ASST 2 cut(s) 69, 128
SgeI CNNG 5 cut(s) 37, 83, 101, 118, 146
Sse9I AATT 2 cut(s) 43, 166
SspMI CTAG 2 cut(s) 71, 134
TaaI ACNGT 1 cut(s) 154
TasI AATT 2 cut(s) 43, 166
TspDTI ATGAA 2 cut(s) 13, 17
XapI RAATTY 1 cut(s) 166
XspI CTAG 2 cut(s) 71, 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.