Rmu_sc0016232.1_g000001

DNA-directed primase polymerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016232.1
OG0001804
Physical Location & Seq
Reverse (-)
921 .. 2799
1879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016232.1_g000001.1.cds

Sequence Viewer

Length: 309 bp
atgtacaatgtaaagcttgtctcaagcaatgctacattagaggcttcttttagcccagatgggatgtttgttatgctccaaacaaggacagcagctgcagtgtcagaaaatgccatagttctaagttttaaatcgagggtcaaccctagttttggaaaatcttacagttggccccaagaatttgcattgaatggttgcaccagtgatgcttcagcaacatacttcctggggaaatctccatttccagctttggatgcatttgtagaatttgttgctacaattggaaatgtctcaggtgctaacttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Herpes_UL52

Protein Analysis

102

Amino Acids

10.86

Weight (kDa)

5.1

Isoelectric Point (pI)

34.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 179, 266
AcuI CTGAAG 1 cut(s) 195
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 225
AluBI AGCT 3 cut(s) 16, 95, 248
AluI AGCT 3 cut(s) 16, 95, 248
Alw26I GTCTC 2 cut(s) 25, 295
AlwNI CAGNNNCTG 1 cut(s) 95
AoxI GGCC 1 cut(s) 170
ApeKI GCWGC 2 cut(s) 92, 95
ApoI RAATTY 2 cut(s) 179, 266
AspS9I GGNCC 1 cut(s) 171
BbvI GCAGC 2 cut(s) 82, 104
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 227
BcoDI GTCTC 2 cut(s) 25, 295
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 96
BisI GCNGC 2 cut(s) 93, 96
BlsI GCNGC 2 cut(s) 94, 97
Bme1390I CCNGG 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 173
BmrFI CCNGG 1 cut(s) 227
BmsI GCATC 2 cut(s) 196, 244
BpuEI CTTGAG 1 cut(s) 7
BsaJI CCNNGG 1 cut(s) 226
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 227
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 2 cut(s) 69, 259
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 34
BseMII CTCAG 1 cut(s) 306
BseNI ACTGG 1 cut(s) 201
BseXI GCAGC 2 cut(s) 82, 104
BshFI GGCC 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 152
BsmAI GTCTC 2 cut(s) 25, 295
BsnI GGCC 1 cut(s) 172
Bsp1407I TGTACA 1 cut(s) 3
BspANI GGCC 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 305
BspLI GGNNCC 1 cut(s) 173
BspMAI CTGCAG 1 cut(s) 100
BsrDI GCAATG 1 cut(s) 34
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 1 cut(s) 201
BssECI CCNNGG 1 cut(s) 226
Bst2UI CCWGG 1 cut(s) 227
Bst4CI ACNGT 1 cut(s) 167
BstAUI TGTACA 1 cut(s) 3
BstDEI CTNAG 2 cut(s) 122, 292
BstF5I GGATG 2 cut(s) 69, 259
BstMAI GTCTC 2 cut(s) 25, 295
BstMWI GCNNNNNNNGC 1 cut(s) 254
BstNI CCWGG 1 cut(s) 227
BstSCI CCNGG 1 cut(s) 225
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 2 cut(s) 82, 104
BsuRI GGCC 1 cut(s) 172
BtsCI GGATG 2 cut(s) 69, 259
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 105, 208
CaiI CAGNNNCTG 1 cut(s) 95
Cfr13I GGNCC 1 cut(s) 171
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 6 cut(s) 16, 44, 54, 95, 172, 248
CviKI_1 RGCY 6 cut(s) 16, 44, 54, 95, 172, 248
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 2 cut(s) 122, 292
DraI TTTAAA 1 cut(s) 130
Eco57I CTGAAG 1 cut(s) 195
EcoRII CCWGG 1 cut(s) 225
EcoT22I ATGCAT 1 cut(s) 259
FaiI YATR 3 cut(s) 74, 116, 220
Fnu4HI GCNGC 2 cut(s) 93, 96
FokI GGATG 2 cut(s) 76, 266
Fsp4HI GCNGC 2 cut(s) 93, 96
FspBI CTAG 1 cut(s) 147
GluI GCNGC 2 cut(s) 93, 96
HaeIII GGCC 1 cut(s) 172
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HindIII AAGCTT 1 cut(s) 14
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 106
Hpy8I GTNNAC 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4V TGCA 4 cut(s) 98, 185, 198, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 254
HpyF3I CTNAG 2 cut(s) 122, 292
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 6 cut(s) 69, 212, 214, 239, 258, 279
Lsp1109I GCAGC 2 cut(s) 82, 104
LweI GCATC 2 cut(s) 196, 244
MaeI CTAG 1 cut(s) 147
MfeI CAATTG 1 cut(s) 279
MluCI AATT 3 cut(s) 179, 266, 279
MnlI CCTC 2 cut(s) 34, 129
Mph1103I ATGCAT 1 cut(s) 259
MseI TTAA 1 cut(s) 129
MspA1I CMGCKG 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 227
MunI CAATTG 1 cut(s) 279
MvaI CCWGG 1 cut(s) 227
MwoI GCNNNNNNNGC 1 cut(s) 254
NlaIV GGNNCC 1 cut(s) 173
NsiI ATGCAT 1 cut(s) 259
PkrI GCNGC 2 cut(s) 94, 97
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 173
PspPI GGNCC 1 cut(s) 171
PstI CTGCAG 1 cut(s) 100
PstNI CAGNNNCTG 1 cut(s) 95
PvuII CAGCTG 1 cut(s) 95
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 2 cut(s) 93, 96
Sau96I GGNCC 1 cut(s) 171
ScrFI CCNGG 1 cut(s) 227
SetI ASST 4 cut(s) 18, 97, 250, 298
SfaNI GCATC 2 cut(s) 196, 244
SfcI CTRYAG 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 3 cut(s) 179, 266, 279
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 225
TaaI ACNGT 1 cut(s) 167
TaqI TCGA 1 cut(s) 134
TasI AATT 3 cut(s) 179, 266, 279
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 2 cut(s) 105, 208
TseI GCWGC 2 cut(s) 92, 95
TspRI CASTG 2 cut(s) 105, 208
XapI RAATTY 2 cut(s) 179, 266
XspI CTAG 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.