Rmu_sc0000289.1_g000005

DNA-directed primase polymerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000289.1
Physical Location & Seq
Reverse (-)
38116 .. 40150
2035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000289.1_g000005.1.cds

Sequence Viewer

Length: 453 bp
atgagctcggttcttttgcgaaaggctaggaaccagtatacttggaaagggtttagggcaatccctaatgctttacaggagctaaaggaagagggtctgaaagagaacttcaatactttccacggcaatttccagggcaatgatgatccaaaatgttcgcagggttcagatgatgagaaaggtgatgagagtgggattcctctactgaaggctctatcatcaaaggcagggaagaatttagtgcttctacctactgggcgcttcaaagctaaggacatgatggtcaaccctagttttggaaaatcttacagttggccccaagaatttgcattgaatggttgcaccagtgatgcttcagcaacatacttcctggggaaatctccatttccagctttggatgcatttgtagaatttgttgctacaattggaaatgtctcaggtgctaacttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

150

Amino Acids

16.33

Weight (kDa)

7.72

Isoelectric Point (pI)

24.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 281
AccI GTMKAC 1 cut(s) 38
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 3 cut(s) 235, 323, 410
AcuI CTGAAG 2 cut(s) 227, 339
AfiI CCNNNNNNNGG 1 cut(s) 296
AgsI TTSAA 3 cut(s) 112, 265, 334
AjnI CCWGG 2 cut(s) 132, 369
AluBI AGCT 4 cut(s) 6, 82, 269, 392
AluI AGCT 4 cut(s) 6, 82, 269, 392
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 1 cut(s) 439
AlwI GGATC 1 cut(s) 140
AoxI GGCC 1 cut(s) 314
ApoI RAATTY 3 cut(s) 235, 323, 410
AspLEI GCGC 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 315
AsuHPI GGTGA 1 cut(s) 194
BanII GRGCYC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 274
BceAI ACGGC 1 cut(s) 139
BciT130I CCWGG 2 cut(s) 134, 371
BcoDI GTCTC 1 cut(s) 439
BfaI CTAG 2 cut(s) 27, 291
BfoI RGCGCY 1 cut(s) 262
Bme1390I CCNGG 2 cut(s) 134, 371
BmgT120I GGNCC 1 cut(s) 315
BmiI GGNNCC 2 cut(s) 32, 317
BmrFI CCNGG 2 cut(s) 134, 371
BmrI ACTGGG 1 cut(s) 264
BmsI GCATC 2 cut(s) 340, 388
BmuI ACTGGG 1 cut(s) 264
Bpu10I CCTNAGC 1 cut(s) 270
BsaJI CCNNGG 3 cut(s) 121, 133, 370
Bsc4I CCNNNNNNNGG 1 cut(s) 296
Bse1I ACTGG 3 cut(s) 34, 259, 345
Bse3DI GCAATG 1 cut(s) 145
BseBI CCWGG 2 cut(s) 134, 371
BseDI CCNNGG 3 cut(s) 121, 133, 370
BseGI GGATG 1 cut(s) 403
BseLI CCNNNNNNNGG 1 cut(s) 296
BseMI GCAATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 450
BseNI ACTGG 3 cut(s) 34, 259, 345
BshFI GGCC 1 cut(s) 316
BsiHKAI GWGCWC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 296
BsmAI GTCTC 1 cut(s) 439
BsnI GGCC 1 cut(s) 316
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 145
BspANI GGCC 1 cut(s) 316
BspCNI CTCAG 1 cut(s) 449
BspLI GGNNCC 2 cut(s) 32, 317
BspPI GGATC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 145
BsrI ACTGG 3 cut(s) 34, 259, 345
BssECI CCNNGG 3 cut(s) 121, 133, 370
BssMI GATC 1 cut(s) 145
BssNAI GTATAC 1 cut(s) 39
Bst1107I GTATAC 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 134, 371
Bst4CI ACNGT 1 cut(s) 311
Bst6I CTCTTC 1 cut(s) 84
BstDEI CTNAG 2 cut(s) 270, 436
BstDSI CCRYGG 1 cut(s) 121
BstF5I GGATG 1 cut(s) 403
BstH2I RGCGCY 1 cut(s) 262
BstHHI GCGC 1 cut(s) 261
BstKTI GATC 1 cut(s) 148
BstMAI GTCTC 1 cut(s) 439
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 398
BstNI CCWGG 2 cut(s) 134, 371
BstSCI CCNGG 2 cut(s) 132, 369
BstZ17I GTATAC 1 cut(s) 39
BsuRI GGCC 1 cut(s) 316
BtgI CCRYGG 1 cut(s) 121
BtsCI GGATG 1 cut(s) 403
BtsIMutI CAGTG 1 cut(s) 352
CfoI GCGC 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 315
CviAII CATG 1 cut(s) 277
CviJI RGCY 7 cut(s) 6, 26, 82, 212, 269, 316, 392
CviKI_1 RGCY 7 cut(s) 6, 26, 82, 212, 269, 316, 392
DdeI CTNAG 2 cut(s) 270, 436
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
DrdI GACNNNNNNGTC 1 cut(s) 281
DseDI GACNNNNNNGTC 1 cut(s) 281
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Ecl136II GAGCTC 1 cut(s) 6
Eco24I GRGCYC 1 cut(s) 8
Eco53kI GAGCTC 1 cut(s) 6
Eco57I CTGAAG 2 cut(s) 227, 339
EcoICRI GAGCTC 1 cut(s) 6
EcoRII CCWGG 2 cut(s) 132, 369
EcoT22I ATGCAT 1 cut(s) 403
EcoT38I GRGCYC 1 cut(s) 8
FaeI CATG 1 cut(s) 280
FaiI YATR 3 cut(s) 39, 278, 364
FatI CATG 1 cut(s) 276
FblI GTMKAC 1 cut(s) 38
FokI GGATG 1 cut(s) 410
FriOI GRGCYC 1 cut(s) 8
FspBI CTAG 2 cut(s) 27, 291
GlaI GCGC 1 cut(s) 260
HaeII RGCGCY 1 cut(s) 262
HaeIII GGCC 1 cut(s) 316
HhaI GCGC 1 cut(s) 261
Hin1II CATG 1 cut(s) 280
Hin6I GCGC 1 cut(s) 259
HinP1I GCGC 1 cut(s) 259
HincII GTYRAC 1 cut(s) 286
HindII GTYRAC 1 cut(s) 286
HinfI GANTC 1 cut(s) 196
HphI GGTGA 1 cut(s) 194
Hpy166II GTNNAC 2 cut(s) 39, 286
Hpy188I TCNGA 2 cut(s) 99, 169
Hpy8I GTNNAC 2 cut(s) 39, 286
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 311
HpyCH4V TGCA 3 cut(s) 329, 342, 401
HpyF10VI GCNNNNNNNGC 1 cut(s) 398
HpyF3I CTNAG 2 cut(s) 270, 436
Hsp92II CATG 1 cut(s) 280
HspAI GCGC 1 cut(s) 259
Kzo9I GATC 1 cut(s) 145
LmnI GCTCC 1 cut(s) 79
LweI GCATC 2 cut(s) 340, 388
MaeI CTAG 2 cut(s) 27, 291
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 2 cut(s) 101, 244
MfeI CAATTG 1 cut(s) 423
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 5 cut(s) 127, 235, 323, 410, 423
MnlI CCTC 2 cut(s) 85, 210
Mph1103I ATGCAT 1 cut(s) 403
MspR9I CCNGG 2 cut(s) 134, 371
MunI CAATTG 1 cut(s) 423
MvaI CCWGG 2 cut(s) 134, 371
MwoI GCNNNNNNNGC 1 cut(s) 398
NdeII GATC 1 cut(s) 145
NlaIII CATG 1 cut(s) 280
NlaIV GGNNCC 2 cut(s) 32, 317
NsiI ATGCAT 1 cut(s) 403
PfeI GAWTC 1 cut(s) 196
Psp124BI GAGCTC 1 cut(s) 8
Psp6I CCWGG 2 cut(s) 132, 369
PspGI CCWGG 2 cut(s) 132, 369
PspN4I GGNNCC 2 cut(s) 32, 317
PspPI GGNCC 1 cut(s) 315
SacI GAGCTC 1 cut(s) 8
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 315
ScrFI CCNGG 2 cut(s) 134, 371
SduI GDGCHC 1 cut(s) 8
SetI ASST 7 cut(s) 8, 84, 184, 253, 271, 394, 442
SfaNI GCATC 2 cut(s) 340, 388
Sse9I AATT 5 cut(s) 127, 235, 323, 410, 423
SspMI CTAG 2 cut(s) 27, 291
SstI GAGCTC 1 cut(s) 8
StyD4I CCNGG 2 cut(s) 132, 369
TaaI ACNGT 1 cut(s) 311
TasI AATT 5 cut(s) 127, 235, 323, 410, 423
TfiI GAWTC 1 cut(s) 196
TscAI CASTG 1 cut(s) 352
TspRI CASTG 1 cut(s) 352
XapI RAATTY 3 cut(s) 235, 323, 410
XmiI GTMKAC 1 cut(s) 38
XspI CTAG 2 cut(s) 27, 291
Zsp2I ATGCAT 1 cut(s) 403
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.