RchiOBHm_Chr2g0118871

respiratory burst oxidase homolog protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
31113689 .. 31116375
2687 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGATATTGCAATGTCACTACCATCAAGTAATAGAAATGCCCACCTACTTGATAACCGCCTACAAAGAAGGAGATGCAGGATCTGCACTTAATGCCATGTTACAGAAACTGCAACATGCGAAGAATGGGGTCGATGTTGTCTTAGAAAGTCAGATAAGGACACATAGTTGTTTTCGGACTTGGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

62

Amino Acids

7.1

Weight (kDa)

6.89

Isoelectric Point (pI)

59.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AclWI GGATC 1 cut(s) 88
AlwI GGATC 1 cut(s) 88
AlwNI CAGNNNCTG 2 cut(s) 83, 109
BccI CCATC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 185
BmsI GCATC 1 cut(s) 64
Bse3DI GCAATG 1 cut(s) 17
BseMI GCAATG 1 cut(s) 17
BsgI GTGCAG 1 cut(s) 69
Bsp143I GATC 1 cut(s) 80
BspACI CCGC 1 cut(s) 57
BspPI GGATC 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 17
BssMI GATC 1 cut(s) 80
BstAPI GCANNNNNTGC 2 cut(s) 83, 92
BstDEI CTNAG 1 cut(s) 142
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BstMWI GCNNNNNNNGC 2 cut(s) 83, 92
BstNSI RCATGY 1 cut(s) 119
BstSFI CTRYAG 1 cut(s) 185
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
CaiI CAGNNNCTG 2 cut(s) 83, 109
CviAII CATG 2 cut(s) 97, 116
CviJI RGCY 1 cut(s) 184
CviKI_1 RGCY 1 cut(s) 184
DdeI CTNAG 1 cut(s) 142
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
FaeI CATG 2 cut(s) 100, 119
FaiI YATR 3 cut(s) 98, 117, 165
FatI CATG 2 cut(s) 96, 115
Hin1II CATG 2 cut(s) 100, 119
Hpy188I TCNGA 2 cut(s) 153, 177
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 4 cut(s) 10, 77, 86, 112
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 92
HpyF3I CTNAG 1 cut(s) 142
Hsp92II CATG 2 cut(s) 100, 119
Kzo9I GATC 1 cut(s) 80
LpnPI CCDG 1 cut(s) 63
LweI GCATC 1 cut(s) 64
MaeIII GTNAC 2 cut(s) 14, 99
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 80
MseI TTAA 1 cut(s) 90
MwoI GCNNNNNNNGC 2 cut(s) 83, 92
NdeII GATC 1 cut(s) 80
NlaIII CATG 2 cut(s) 100, 119
NmuCI GTSAC 1 cut(s) 14
NspI RCATGY 1 cut(s) 119
PstNI CAGNNNCTG 2 cut(s) 83, 109
PsuI RGATCY 1 cut(s) 80
SaqAI TTAA 1 cut(s) 90
Sau3AI GATC 1 cut(s) 80
SetI ASST 1 cut(s) 47
SfaNI GCATC 1 cut(s) 64
SfcI CTRYAG 1 cut(s) 185
SgeI CNNG 5 cut(s) 38, 61, 90, 109, 128
SsiI CCGC 1 cut(s) 57
TaqI TCGA 1 cut(s) 132
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
XceI RCATGY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.