Rorug02G0648200

BONZAI 3-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0002274
Physical Location & Seq
Forward (+)
75774492 .. 75775784
1293 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0648200.1

Sequence Viewer

Length: 720 bp
ATGTCTATGTTTCTAGTGAAAAGGATAAAATTTCCCCAACTTTTTGCATACAGTTGTATCTCCATCATCTCTATTTCCCTCATTATCCACACAAAAAGAAAGACTACTCATCTTCAACAATGTGATAATGCTCTCAGAGCTGAAATCCATACCAGAAGCCTAGCTAGGCAGTTCATCTCCATTAATTTTGCCATGAATCCAGTAATTCTCTTTCTTATTTCCTCTATGTTTTTTCAGTCAGCTATTCTGGGAGGTGAATCAGCAAGGGCTAAGGCAGAAAAAGGTAACTCCCAGATTATTGTAATGGGCCTTGTTTACTGTGACATCTGCTCCAACAACACCTTCTCCCCTCACAGCTACTTCATTCCAGGTGCTGAGGTTAAAATAAATTGCATATTCAAAGCAGTGTCACCAAGAATTGCAGAACACATATCATTCTCAGCGAATAGAACTACAAACAGGTATGGGGTGTACAAGTTGGAAATCCCATCAGTTGAGGGAATCAAATGTGCAGAAGATTCTGCGATAGTTTCTTCCTGCCAGGCAAGCTTAATGCGGAGTGGATCTCCAGCTTGTAATGTTCCTGGTTACAAATCCACATCAGATGAAATAGCAATCAAATCAAAGGAAGCTAATCTCTGCATCTACAGCCTCAATGCTTTGAATTTCAGACCATCAAGGAGAGACATTGCCTTATGTGGCAAGAAAAAAATTAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0008150 GO:0009987 GO:0010118 GO:0010941 GO:0016020 GO:0044464 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0060548 GO:0065007 GO:0071944 GO:0090332
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2 Copine

Protein Analysis

239

Amino Acids

26.43

Weight (kDa)

9.49

Isoelectric Point (pI)

45.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 101 - 199 2.4e-19 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 556
AclWI GGATC 1 cut(s) 571
AcsI RAATTY 2 cut(s) 29, 664
AfaI GTAC 1 cut(s) 473
AgsI TTSAA 3 cut(s) 116, 400, 664
AjnI CCWGG 3 cut(s) 367, 540, 583
AjuI GAANNNNNNNTTGG 2 cut(s) 326, 358
AluBI AGCT 7 cut(s) 140, 164, 242, 357, 549, 572, 632
AluI AGCT 7 cut(s) 140, 164, 242, 357, 549, 572, 632
Alw26I GTCTC 1 cut(s) 678
AlwI GGATC 1 cut(s) 571
AlwNI CAGNNNCTG 1 cut(s) 374
AoxI GGCC 1 cut(s) 307
ApoI RAATTY 2 cut(s) 29, 664
AseI ATTAAT 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 307
AsuHPI GGTGA 2 cut(s) 266, 402
BaeI ACNNNNGTAYC 2 cut(s) 40, 73
BbvCI CCTCAGC 1 cut(s) 375
BccI CCATC 3 cut(s) 71, 496, 682
BciT130I CCWGG 3 cut(s) 369, 542, 585
BcoDI GTCTC 1 cut(s) 678
BfaI CTAG 3 cut(s) 14, 161, 165
BfmI CTRYAG 1 cut(s) 646
Bme1390I CCNGG 3 cut(s) 369, 542, 585
BmgT120I GGNCC 1 cut(s) 307
BmrFI CCNGG 3 cut(s) 369, 542, 585
BmsI GCATC 1 cut(s) 651
BplI GAGNNNNNCTC 2 cut(s) 550, 582
BpmI CTGGAG 1 cut(s) 552
Bpu10I CCTNAGC 2 cut(s) 270, 375
BsaXI ACNNNNNCTCC 4 cut(s) 314, 329, 344, 359
Bse1I ACTGG 1 cut(s) 200
Bse3DI GCAATG 1 cut(s) 687
BseBI CCWGG 3 cut(s) 369, 542, 585
BseMI GCAATG 1 cut(s) 687
BseMII CTCAG 3 cut(s) 148, 366, 453
BseNI ACTGG 1 cut(s) 200
BsgI GTGCAG 1 cut(s) 531
BshFI GGCC 1 cut(s) 309
BsmAI GTCTC 1 cut(s) 678
BsnI GGCC 1 cut(s) 309
Bsp1407I TGTACA 1 cut(s) 471
Bsp143I GATC 1 cut(s) 563
BspACI CCGC 1 cut(s) 556
BspANI GGCC 1 cut(s) 309
BspCNI CTCAG 3 cut(s) 147, 367, 452
BspPI GGATC 1 cut(s) 571
BsrDI GCAATG 1 cut(s) 687
BsrGI TGTACA 1 cut(s) 471
BsrI ACTGG 1 cut(s) 200
BssMI GATC 1 cut(s) 563
Bst2UI CCWGG 3 cut(s) 369, 542, 585
Bst4CI ACNGT 2 cut(s) 53, 320
BstAUI TGTACA 1 cut(s) 471
BstC8I GCNNGC 1 cut(s) 547
BstDEI CTNAG 4 cut(s) 134, 270, 375, 439
BstKTI GATC 1 cut(s) 566
BstMAI GTCTC 1 cut(s) 678
BstMBI GATC 1 cut(s) 563
BstMWI GCNNNNNNNGC 3 cut(s) 137, 546, 648
BstNI CCWGG 3 cut(s) 369, 542, 585
BstSCI CCNGG 3 cut(s) 367, 540, 583
BstSFI CTRYAG 1 cut(s) 646
BstX2I RGATCY 1 cut(s) 563
BstYI RGATCY 1 cut(s) 563
BsuRI GGCC 1 cut(s) 309
BtsI GCAGTG 1 cut(s) 411
BtsIMutI CAGTG 1 cut(s) 411
Cac8I GCNNGC 1 cut(s) 547
CaiI CAGNNNCTG 1 cut(s) 374
Cfr13I GGNCC 1 cut(s) 307
Csp6I GTAC 1 cut(s) 472
CviAII CATG 1 cut(s) 193
CviQI GTAC 1 cut(s) 472
DdeI CTNAG 4 cut(s) 134, 270, 375, 439
DpnI GATC 1 cut(s) 565
DpnII GATC 1 cut(s) 563
EcoRII CCWGG 3 cut(s) 367, 540, 583
FaeI CATG 1 cut(s) 196
FaiI YATR 9 cut(s) 8, 49, 150, 194, 227, 395, 431, 465, 697
FatI CATG 1 cut(s) 192
FspBI CTAG 3 cut(s) 14, 161, 165
GsuI CTGGAG 1 cut(s) 552
HaeIII GGCC 1 cut(s) 309
Hin1II CATG 1 cut(s) 196
HindIII AAGCTT 1 cut(s) 547
HinfI GANTC 4 cut(s) 196, 257, 501, 518
HphI GGTGA 2 cut(s) 266, 402
Hpy166II GTNNAC 2 cut(s) 316, 472
Hpy188I TCNGA 3 cut(s) 137, 604, 671
Hpy8I GTNNAC 2 cut(s) 316, 472
HpyAV CCTTC 1 cut(s) 352
HpyCH4III ACNGT 2 cut(s) 53, 320
HpyCH4V TGCA 5 cut(s) 47, 393, 422, 512, 642
HpyF10VI GCNNNNNNNGC 3 cut(s) 137, 546, 648
HpyF3I CTNAG 4 cut(s) 134, 270, 375, 439
Hsp92II CATG 1 cut(s) 196
Kzo9I GATC 1 cut(s) 563
LmnI GCTCC 1 cut(s) 335
LweI GCATC 1 cut(s) 651
MaeI CTAG 3 cut(s) 14, 161, 165
MaeIII GTNAC 4 cut(s) 284, 320, 408, 587
MalI GATC 1 cut(s) 565
MboI GATC 1 cut(s) 563
MboII GAAGA 3 cut(s) 104, 525, 527
MflI RGATCY 1 cut(s) 563
MluCI AATT 7 cut(s) 29, 184, 204, 388, 417, 664, 711
MmeI TCCRAC 2 cut(s) 357, 459
MnlI CCTC 7 cut(s) 89, 232, 245, 360, 370, 490, 662
MseI TTAA 3 cut(s) 183, 381, 551
MspR9I CCNGG 3 cut(s) 369, 542, 585
MvaI CCWGG 3 cut(s) 369, 542, 585
MwoI GCNNNNNNNGC 3 cut(s) 137, 546, 648
NdeII GATC 1 cut(s) 563
NlaIII CATG 1 cut(s) 196
NmuCI GTSAC 2 cut(s) 320, 408
PfeI GAWTC 4 cut(s) 196, 257, 501, 518
PshBI ATTAAT 1 cut(s) 183
Psp6I CCWGG 3 cut(s) 367, 540, 583
PspGI CCWGG 3 cut(s) 367, 540, 583
PspPI GGNCC 1 cut(s) 307
PstNI CAGNNNCTG 1 cut(s) 374
PsuI RGATCY 1 cut(s) 563
RsaI GTAC 1 cut(s) 473
RsaNI GTAC 1 cut(s) 472
SaqAI TTAA 3 cut(s) 183, 381, 551
Sau3AI GATC 1 cut(s) 563
Sau96I GGNCC 1 cut(s) 307
ScrFI CCNGG 3 cut(s) 369, 542, 585
SfaNI GCATC 1 cut(s) 651
SfcI CTRYAG 1 cut(s) 646
Sse9I AATT 7 cut(s) 29, 184, 204, 388, 417, 664, 711
SsiI CCGC 1 cut(s) 556
SspMI CTAG 3 cut(s) 14, 161, 165
StyD4I CCNGG 3 cut(s) 367, 540, 583
TaaI ACNGT 2 cut(s) 53, 320
TasI AATT 7 cut(s) 29, 184, 204, 388, 417, 664, 711
TatI WGTACW 1 cut(s) 471
TfiI GAWTC 4 cut(s) 196, 257, 501, 518
Tru1I TTAA 3 cut(s) 183, 381, 551
Tru9I TTAA 3 cut(s) 183, 381, 551
TscAI CASTG 1 cut(s) 411
TseFI GTSAC 2 cut(s) 320, 408
Tsp45I GTSAC 2 cut(s) 320, 408
TspDTI ATGAA 4 cut(s) 163, 209, 352, 621
TspRI CASTG 1 cut(s) 411
VspI ATTAAT 1 cut(s) 183
XapI RAATTY 2 cut(s) 29, 664
XspI CTAG 3 cut(s) 14, 161, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.