Rh4BG209700

respiratory burst oxidase homolog protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
36303775 .. 36306330
2556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG209700.1

Sequence Viewer

Length: 210 bp
ATGATATTGCAGTGTCACTACCATCAAGTAATAGAAATGCCCACCTACTTGATAACCGCCTACAAAGAAGGAGGTGCAGGATTTGCACTTAATGCCATGTTACAGAAACTACAACATGCGAAGAATGGGGTCGATGTTGTCTTAGAAAGTCAGATAAGGACACATAGTTGTTTTCAGACTTGGCTGCAGCACATGAATCATCTTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

69

Amino Acids

7.97

Weight (kDa)

6.57

Isoelectric Point (pI)

59.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AgsI TTSAA 1 cut(s) 206
ApeKI GCWGC 2 cut(s) 184, 187
BbvI GCAGC 2 cut(s) 171, 199
BccI CCATC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 185
BisI GCNGC 2 cut(s) 185, 188
BlsI GCNGC 2 cut(s) 186, 189
BseXI GCAGC 2 cut(s) 171, 199
BsgI GTGCAG 1 cut(s) 96
BspACI CCGC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 189
BstAPI GCANNNNNTGC 2 cut(s) 83, 92
BstDEI CTNAG 1 cut(s) 142
BstMWI GCNNNNNNNGC 2 cut(s) 83, 92
BstNSI RCATGY 1 cut(s) 119
BstSFI CTRYAG 1 cut(s) 185
BstV1I GCAGC 2 cut(s) 171, 199
BtsI GCAGTG 1 cut(s) 17
BtsIMutI CAGTG 1 cut(s) 17
CviAII CATG 3 cut(s) 97, 116, 193
CviJI RGCY 1 cut(s) 184
CviKI_1 RGCY 1 cut(s) 184
DdeI CTNAG 1 cut(s) 142
FaeI CATG 3 cut(s) 100, 119, 196
FaiI YATR 4 cut(s) 98, 117, 165, 194
FatI CATG 3 cut(s) 96, 115, 192
Fnu4HI GCNGC 2 cut(s) 185, 188
Fsp4HI GCNGC 2 cut(s) 185, 188
GluI GCNGC 2 cut(s) 185, 188
Hin1II CATG 3 cut(s) 100, 119, 196
HinfI GANTC 1 cut(s) 196
Hpy188I TCNGA 2 cut(s) 153, 177
Hpy188III TCNNGA 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 4 cut(s) 10, 77, 86, 187
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 92
HpyF3I CTNAG 1 cut(s) 142
Hsp92II CATG 3 cut(s) 100, 119, 196
LpnPI CCDG 1 cut(s) 63
Lsp1109I GCAGC 2 cut(s) 171, 199
MaeIII GTNAC 2 cut(s) 14, 99
MboII GAAGA 1 cut(s) 133
MnlI CCTC 1 cut(s) 65
MseI TTAA 1 cut(s) 90
MwoI GCNNNNNNNGC 2 cut(s) 83, 92
NlaIII CATG 3 cut(s) 100, 119, 196
NmuCI GTSAC 1 cut(s) 14
NspI RCATGY 1 cut(s) 119
PfeI GAWTC 1 cut(s) 196
PkrI GCNGC 2 cut(s) 186, 189
PstI CTGCAG 1 cut(s) 189
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 2 cut(s) 185, 188
SetI ASST 2 cut(s) 47, 76
SfcI CTRYAG 1 cut(s) 185
SgeI CNNG 7 cut(s) 38, 61, 90, 109, 128, 192, 205
SsiI CCGC 1 cut(s) 57
TaqI TCGA 1 cut(s) 132
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 17
TseFI GTSAC 1 cut(s) 14
TseI GCWGC 2 cut(s) 184, 187
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 209
TspRI CASTG 1 cut(s) 17
XceI RCATGY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.