Rroxscaffold_2G00095170

respiratory burst oxidase homolog protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
16485578 .. 16489112
3535 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00095170.1

Sequence Viewer

Length: 204 bp
ATGATATTGCAGTGTCACTACCATCAAGTAATAGAAATGCCCACCTACTTGACAACCGCCTACAAAGAAGGAGATGCAGGATCTGCACTTAATGCCATGTTACAGAAACTGCAACATGCGAAGAATGGGGTCGATGTTGTCTTAGAAAGTCAGATAAGGACACAATTGTTTTCGGACTTGGCTGCAGCACATGAATCATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

67

Amino Acids

7.42

Weight (kDa)

5.65

Isoelectric Point (pI)

54.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AclWI GGATC 1 cut(s) 88
AlwI GGATC 1 cut(s) 88
AlwNI CAGNNNCTG 2 cut(s) 83, 109
ApeKI GCWGC 2 cut(s) 182, 185
BbvI GCAGC 2 cut(s) 169, 197
BccI CCATC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 183
BisI GCNGC 2 cut(s) 183, 186
BlsI GCNGC 2 cut(s) 184, 187
BmsI GCATC 1 cut(s) 64
BseXI GCAGC 2 cut(s) 169, 197
BsgI GTGCAG 1 cut(s) 69
Bsp143I GATC 1 cut(s) 80
BspACI CCGC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 187
BspPI GGATC 1 cut(s) 88
BssMI GATC 1 cut(s) 80
BstAPI GCANNNNNTGC 2 cut(s) 83, 92
BstDEI CTNAG 1 cut(s) 142
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BstMWI GCNNNNNNNGC 2 cut(s) 83, 92
BstNSI RCATGY 1 cut(s) 119
BstSFI CTRYAG 1 cut(s) 183
BstV1I GCAGC 2 cut(s) 169, 197
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
BtsI GCAGTG 1 cut(s) 17
BtsIMutI CAGTG 1 cut(s) 17
CaiI CAGNNNCTG 2 cut(s) 83, 109
CviAII CATG 3 cut(s) 97, 116, 191
CviJI RGCY 1 cut(s) 182
CviKI_1 RGCY 1 cut(s) 182
DdeI CTNAG 1 cut(s) 142
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
FaeI CATG 3 cut(s) 100, 119, 194
FaiI YATR 3 cut(s) 98, 117, 192
FatI CATG 3 cut(s) 96, 115, 190
Fnu4HI GCNGC 2 cut(s) 183, 186
Fsp4HI GCNGC 2 cut(s) 183, 186
GluI GCNGC 2 cut(s) 183, 186
Hin1II CATG 3 cut(s) 100, 119, 194
HinfI GANTC 1 cut(s) 194
Hpy188I TCNGA 2 cut(s) 153, 175
Hpy188III TCNNGA 1 cut(s) 201
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 5 cut(s) 10, 77, 86, 112, 185
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 92
HpyF3I CTNAG 1 cut(s) 142
Hsp92II CATG 3 cut(s) 100, 119, 194
Kzo9I GATC 1 cut(s) 80
LpnPI CCDG 1 cut(s) 63
Lsp1109I GCAGC 2 cut(s) 169, 197
LweI GCATC 1 cut(s) 64
MaeIII GTNAC 2 cut(s) 14, 99
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 1 cut(s) 133
MfeI CAATTG 1 cut(s) 164
MflI RGATCY 1 cut(s) 80
MluCI AATT 1 cut(s) 164
MseI TTAA 1 cut(s) 90
MunI CAATTG 1 cut(s) 164
MwoI GCNNNNNNNGC 2 cut(s) 83, 92
NdeII GATC 1 cut(s) 80
NlaIII CATG 3 cut(s) 100, 119, 194
NmuCI GTSAC 1 cut(s) 14
NspI RCATGY 1 cut(s) 119
PfeI GAWTC 1 cut(s) 194
PkrI GCNGC 2 cut(s) 184, 187
PstI CTGCAG 1 cut(s) 187
PstNI CAGNNNCTG 2 cut(s) 83, 109
PsuI RGATCY 1 cut(s) 80
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 2 cut(s) 183, 186
Sau3AI GATC 1 cut(s) 80
SetI ASST 1 cut(s) 47
SfaNI GCATC 1 cut(s) 64
SfcI CTRYAG 1 cut(s) 183
SgeI CNNG 6 cut(s) 38, 61, 90, 109, 128, 190
Sse9I AATT 1 cut(s) 164
SsiI CCGC 1 cut(s) 57
TaqI TCGA 1 cut(s) 132
TasI AATT 1 cut(s) 164
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 17
TseFI GTSAC 1 cut(s) 14
TseI GCWGC 2 cut(s) 182, 185
Tsp45I GTSAC 1 cut(s) 14
TspRI CASTG 1 cut(s) 17
XceI RCATGY 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.