Rh7BG086700

respiratory burst oxidase homolog protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0002274
Physical Location & Seq
Reverse (-)
6331610 .. 6335076
3467 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG086700.1

Sequence Viewer

Length: 174 bp
ATGCCCACCTACTTGATAACCGCCTACAAAGAAGGAGATGCAGGATCTGCACTTAATACCATGTTACAGAAACTGCAACATGCTAAGAATGGGGTCGATGTTGTCTTAGAAAGTCAGATAAGGACACATAATTGTTTTCGTACTTGGCTGCAGCACATGAATCATCTTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04624 map04013 map04624
Pfam Domains
Protein Families
EF-hand_6 FAD_binding_8 Ferric_reduct NADPH_Ox NAD_binding_6

Protein Analysis

57

Amino Acids

6.55

Weight (kDa)

6.9

Isoelectric Point (pI)

36.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 21
AclWI GGATC 1 cut(s) 52
AfaI GTAC 1 cut(s) 142
AgsI TTSAA 1 cut(s) 170
AlwI GGATC 1 cut(s) 52
AlwNI CAGNNNCTG 2 cut(s) 47, 73
ApeKI GCWGC 2 cut(s) 148, 151
BbvI GCAGC 2 cut(s) 135, 163
BfmI CTRYAG 1 cut(s) 149
BisI GCNGC 2 cut(s) 149, 152
BlsI GCNGC 2 cut(s) 150, 153
BmsI GCATC 1 cut(s) 28
BseXI GCAGC 2 cut(s) 135, 163
BsgI GTGCAG 1 cut(s) 33
Bsp143I GATC 1 cut(s) 44
BspACI CCGC 1 cut(s) 21
BspMAI CTGCAG 1 cut(s) 153
BspPI GGATC 1 cut(s) 52
BssMI GATC 1 cut(s) 44
BstAPI GCANNNNNTGC 1 cut(s) 47
BstDEI CTNAG 2 cut(s) 84, 106
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 149
BstV1I GCAGC 2 cut(s) 135, 163
BstX2I RGATCY 1 cut(s) 44
BstYI RGATCY 1 cut(s) 44
CaiI CAGNNNCTG 2 cut(s) 47, 73
Csp6I GTAC 1 cut(s) 141
CviAII CATG 3 cut(s) 61, 80, 157
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
CviQI GTAC 1 cut(s) 141
DdeI CTNAG 2 cut(s) 84, 106
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
FaeI CATG 3 cut(s) 64, 83, 160
FaiI YATR 4 cut(s) 62, 81, 129, 158
FatI CATG 3 cut(s) 60, 79, 156
Fnu4HI GCNGC 2 cut(s) 149, 152
Fsp4HI GCNGC 2 cut(s) 149, 152
GluI GCNGC 2 cut(s) 149, 152
Hin1II CATG 3 cut(s) 64, 83, 160
HinfI GANTC 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 117
Hpy188III TCNNGA 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 26
HpyCH4V TGCA 4 cut(s) 41, 50, 76, 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 2 cut(s) 84, 106
Hsp92II CATG 3 cut(s) 64, 83, 160
Kzo9I GATC 1 cut(s) 44
LpnPI CCDG 1 cut(s) 27
Lsp1109I GCAGC 2 cut(s) 135, 163
LweI GCATC 1 cut(s) 28
MaeIII GTNAC 1 cut(s) 63
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MflI RGATCY 1 cut(s) 44
MluCI AATT 1 cut(s) 130
MseI TTAA 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 47
NdeII GATC 1 cut(s) 44
NlaIII CATG 3 cut(s) 64, 83, 160
NspI RCATGY 1 cut(s) 83
PfeI GAWTC 1 cut(s) 160
PkrI GCNGC 2 cut(s) 150, 153
PstI CTGCAG 1 cut(s) 153
PstNI CAGNNNCTG 2 cut(s) 47, 73
PsuI RGATCY 1 cut(s) 44
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 2 cut(s) 149, 152
Sau3AI GATC 1 cut(s) 44
SetI ASST 1 cut(s) 11
SfaNI GCATC 1 cut(s) 28
SfcI CTRYAG 1 cut(s) 149
SgeI CNNG 6 cut(s) 25, 54, 73, 92, 156, 169
Sse9I AATT 1 cut(s) 130
SsiI CCGC 1 cut(s) 21
TaqI TCGA 1 cut(s) 96
TasI AATT 1 cut(s) 130
TfiI GAWTC 1 cut(s) 160
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseI GCWGC 2 cut(s) 148, 151
TspDTI ATGAA 1 cut(s) 173
XceI RCATGY 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.