RchiOBHm_Chr2g0140521

U4 U6 small nuclear ribonucleoprotein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001559
Physical Location & Seq
Reverse (-)
58000071 .. 58003399
3329 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGGAGCAAGATGTCAATGGGGACTTGGCAAACTTAAAGACAGTTAACTATGATGATCTGGATAGTGTTTCAAAATTGCAAAAATCACAAAGATTTGCCGATATAATGCAGCTGTGTTTCAAAATGACTCTTTTACTTATTCTTGGCAGATGTTTTGGTCTCCAAAAATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
Nop Prp31_C

Protein Analysis

57

Amino Acids

6.56

Weight (kDa)

6.01

Isoelectric Point (pI)

36.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 167
AgsI TTSAA 2 cut(s) 72, 121
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 164
ApeKI GCWGC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 167
BbvI GCAGC 1 cut(s) 121
BcoDI GTCTC 1 cut(s) 164
BisI GCNGC 1 cut(s) 110
BlsI GCNGC 1 cut(s) 111
BsaI GGTCTC 1 cut(s) 164
BseXI GCAGC 1 cut(s) 121
BslFI GGGAC 1 cut(s) 35
BsmAI GTCTC 1 cut(s) 164
BsmFI GGGAC 1 cut(s) 35
Bso31I GGTCTC 1 cut(s) 164
Bsp143I GATC 1 cut(s) 55
BspTNI GGTCTC 1 cut(s) 164
BssMI GATC 1 cut(s) 55
Bst4CI ACNGT 1 cut(s) 43
BstKTI GATC 1 cut(s) 58
BstMAI GTCTC 1 cut(s) 164
BstMBI GATC 1 cut(s) 55
BstV1I GCAGC 1 cut(s) 121
CviJI RGCY 1 cut(s) 112
CviKI_1 RGCY 1 cut(s) 112
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
Eco31I GGTCTC 1 cut(s) 164
FaiI YATR 2 cut(s) 51, 104
FaqI GGGAC 1 cut(s) 35
Fnu4HI GCNGC 1 cut(s) 110
Fsp4HI GCNGC 1 cut(s) 110
FspEI CC 8 cut(s) 3, 4, 5, 11, 44, 112, 129, 141
GluI GCNGC 1 cut(s) 110
HincII GTYRAC 1 cut(s) 46
HindII GTYRAC 1 cut(s) 46
HinfI GANTC 1 cut(s) 127
HpaI GTTAAC 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 79, 109
KspAI GTTAAC 1 cut(s) 46
Kzo9I GATC 1 cut(s) 55
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 44
Lsp1109I GCAGC 1 cut(s) 121
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MluCI AATT 2 cut(s) 74, 167
MlyI GAGTC 1 cut(s) 121
MseI TTAA 3 cut(s) 35, 45, 172
MspA1I CMGCKG 1 cut(s) 112
NdeII GATC 1 cut(s) 55
PkrI GCNGC 1 cut(s) 111
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
PvuII CAGCTG 1 cut(s) 112
SaqAI TTAA 3 cut(s) 35, 45, 172
SatI GCNGC 1 cut(s) 110
Sau3AI GATC 1 cut(s) 55
SchI GAGTC 1 cut(s) 121
SetI ASST 1 cut(s) 114
SgeI CNNG 4 cut(s) 20, 37, 71, 155
Sse9I AATT 2 cut(s) 74, 167
TaaI ACNGT 1 cut(s) 43
TasI AATT 2 cut(s) 74, 167
Tru1I TTAA 3 cut(s) 35, 45, 172
Tru9I TTAA 3 cut(s) 35, 45, 172
TseI GCWGC 1 cut(s) 109
XapI RAATTY 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.