RchiOBHm_Chr2g0155311

phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
72233475 .. 72235559
2085 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGAAGACACGAAGACGATTGGAGCTTCTTCTAGAGGATCTTCCTTGTTATTTTAGTCTAACGGAGTATTATGACACATCAGATGAAGTTATAGAACTCCCTCCCTCCCTCTCTCTCTCTCTCTCTGCAGACACAAATGTGCTGTATCTGCATGCATATAGACTTCTTATCAATCATGTGGATCTGGGATACTAG

Protein Analysis

64

Amino Acids

7.49

Weight (kDa)

4.63

Isoelectric Point (pI)

42.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 45, 189
AleI CACNNNNGTG 1 cut(s) 137
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
AlwI GGATC 2 cut(s) 45, 189
BbsI GAAGAC 2 cut(s) 11, 19
BciVI GTATCC 1 cut(s) 182
BfaI CTAG 2 cut(s) 32, 193
BfmI CTRYAG 1 cut(s) 126
BfuI GTATCC 1 cut(s) 182
BpiI GAAGAC 2 cut(s) 11, 19
Bsp143I GATC 2 cut(s) 37, 181
BspMAI CTGCAG 1 cut(s) 130
BspPI GGATC 2 cut(s) 45, 189
BssMI GATC 2 cut(s) 37, 181
BstC8I GCNNGC 1 cut(s) 153
BstKTI GATC 2 cut(s) 40, 184
BstMBI GATC 2 cut(s) 37, 181
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNSI RCATGY 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 126
BstV2I GAAGAC 2 cut(s) 11, 19
BstX2I RGATCY 2 cut(s) 37, 181
BstYI RGATCY 2 cut(s) 37, 181
BsuI GTATCC 1 cut(s) 182
Cac8I GCNNGC 1 cut(s) 153
CviAII CATG 2 cut(s) 152, 176
CviJI RGCY 1 cut(s) 25
CviKI_1 RGCY 1 cut(s) 25
DpnI GATC 2 cut(s) 39, 183
DpnII GATC 2 cut(s) 37, 181
EcoT22I ATGCAT 1 cut(s) 157
FaeI CATG 2 cut(s) 155, 179
FaiI YATR 6 cut(s) 72, 92, 153, 157, 159, 177
FatI CATG 2 cut(s) 151, 175
FspBI CTAG 2 cut(s) 32, 193
Hin1II CATG 2 cut(s) 155, 179
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 32
HpyCH4V TGCA 3 cut(s) 128, 151, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
Hsp92II CATG 2 cut(s) 155, 179
Kzo9I GATC 2 cut(s) 37, 181
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 170
MaeI CTAG 2 cut(s) 32, 193
MalI GATC 2 cut(s) 39, 183
MboI GATC 2 cut(s) 37, 181
MboII GAAGA 4 cut(s) 16, 20, 24, 32
MflI RGATCY 2 cut(s) 37, 181
MnlI CCTC 4 cut(s) 28, 111, 115, 119
Mph1103I ATGCAT 1 cut(s) 157
MslI CAYNNNNRTG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 2 cut(s) 37, 181
NlaIII CATG 2 cut(s) 155, 179
NsiI ATGCAT 1 cut(s) 157
NspI RCATGY 1 cut(s) 155
OliI CACNNNNGTG 1 cut(s) 137
PaeI GCATGC 1 cut(s) 155
PstI CTGCAG 1 cut(s) 130
PsuI RGATCY 2 cut(s) 37, 181
RseI CAYNNNNRTG 1 cut(s) 137
Sau3AI GATC 2 cut(s) 37, 181
SetI ASST 1 cut(s) 27
SfcI CTRYAG 1 cut(s) 126
SgeI CNNG 5 cut(s) 21, 44, 57, 164, 188
SmiMI CAYNNNNRTG 1 cut(s) 137
SphI GCATGC 1 cut(s) 155
SspMI CTAG 2 cut(s) 32, 193
TspDTI ATGAA 2 cut(s) 17, 99
TspGWI ACGGA 1 cut(s) 77
XbaI TCTAGA 1 cut(s) 31
XceI RCATGY 1 cut(s) 155
XspI CTAG 2 cut(s) 32, 193
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.