Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001376.1

Orthogroup ID

OG0002283

Physical Location & Seq

Genomic Coordinates Reverse (-)

47211 .. 50041

Gene Structure 2831 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001376.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 612 bp

atgctcctcccctgcccctgggcttcagacggggtcagaagtgaattacgagtcggaccaatttgcgactcccttgcatgcaatgatgtggcgaacctctcgatcattctaattcagtgctctccagagagcaatttcgtcgatacgggatggtccggaatctccaaaatctccaatagcaagcaaagtctccatcccagaactctcttcataatgctactctcgttgccaaaaggaaaatgcttgctgagccccaggttggaaggtccagtttccagaagcttttggagccaaggccccactcagagatctgcagttactccttatagaattgttcttggtaatataaaagacaagcaatcatgtggatcagggatcctagctgatggtcggcttgatgatttgatccaaagagttgctacctttgggatgaagaagttgttaccccaggctgagcttggcttcgtcaacataggaagctgcccctcaagaagaaagaactctactggaattggacatcttcgggcaattccatgggtgtttgcatggactcaaaccggatttgtcttccagcttggcttggagttaaaccccttgttgatctttttgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004611 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006082 GO:0006091 GO:0006099 GO:0006101 GO:0008150 GO:0008152 GO:0008964 GO:0009060 GO:0009987 GO:0015980 GO:0016829 GO:0016830 GO:0016831 GO:0016999 GO:0017144 GO:0019752 GO:0043436 GO:0044237 GO:0044238 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0045333 GO:0055114 GO:0071704 GO:0072350

KEGG Pathways

Metabolic & Signaling

ko00620 ko00680 ko00710 ko00720 ko01100 ko01120 ko01200 map00620 map00680 map00710 map00720 map01100 map01120 map01200

Pfam Domains

Protein Families

PEPcase

Protein Analysis

203

Amino Acids

22.19

Weight (kDa)

9.39

Isoelectric Point (pI)

46.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002283)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0314571 RchiOBHm_Chr1g0333411 RchiOBHm_Chr1g0341171 RchiOBHm_Chr1g0355601 RchiOBHm_Chr1g0362661 RchiOBHm_Chr2g0135871 RchiOBHm_Chr2g0155311 RchiOBHm_Chr4g0426971 RchiOBHm_Chr4g0434611 RchiOBHm_Chr5g0016171 RchiOBHm_Chr5g0016231 RchiOBHm_Chr6g0248021 RchiOBHm_Chr6g0302761
rosa_laevigata	RLG00000002685 RLG00000008332 RLG00000009004 RLG00000018585 RLG00000023270 RLG00000025198
rosa_multiflora	Rmu_sc0001376.1_g000006 Rmu_sc0002968.1_g000005
rosa_roxburghii	Rroxscaffold_3G00219200
rosa_rugosa	Rorug01G0313400 Rorug05G0478600
rosa_samantha	Rh1CG246800 Rh2AG443800 Rh2AG514200 Rh2AG551000 Rh2BG052200 Rh2CG430800 Rh2CG499100 Rh4AG183700 Rh4CG195700 Rh4DG179000 Rh5CG135500 Rh5CG135700 Rh5DG275400 Rh5DG564200 Rh6BG040300 Rh7DG279100
rosa_wichuraiana	Rw2G011220 Rw4G022300 Rw7G012030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	155
AclWI	GGATC	4 cut(s)	370, 376, 383, 400
AcuI	CTGAAG	1 cut(s)	9
AfiI	CCNNNNNNNGG	2 cut(s)	18, 259
AjnI	CCWGG	3 cut(s)	17, 254, 447
AluBI	AGCT	5 cut(s)	282, 383, 457, 480, 574
AluI	AGCT	5 cut(s)	282, 383, 457, 480, 574
Alw21I	GWGCWC	1 cut(s)	122
Alw26I	GTCTC	1 cut(s)	194
AlwI	GGATC	4 cut(s)	370, 376, 383, 400
Aor13HI	TCCGGA	1 cut(s)	155
AoxI	GGCC	1 cut(s)	295
ApeKI	GCWGC	1 cut(s)	480
AspS9I	GGNCC	4 cut(s)	56, 153, 266, 296
AvaII	GGWCC	3 cut(s)	56, 153, 266
BamHI	GGATCC	1 cut(s)	375
BanII	GRGCYC	1 cut(s)	254
BbsI	GAAGAC	1 cut(s)	559
Bbv12I	GWGCWC	1 cut(s)	122
BbvI	GCAGC	1 cut(s)	467
BccI	CCATC	3 cut(s)	144, 201, 380
BcgI	CGANNNNNNTGC	4 cut(s)	56, 90, 121, 155
BciT130I	CCWGG	3 cut(s)	19, 256, 449
BcoDI	GTCTC	1 cut(s)	194
BfaI	CTAG	1 cut(s)	380
BfmI	CTRYAG	1 cut(s)	312
BglII	AGATCT	1 cut(s)	308
BisI	GCNGC	1 cut(s)	481
BlpI	GCTNAGC	2 cut(s)	248, 453
BlsI	GCNGC	1 cut(s)	482
Bme1390I	CCNGG	3 cut(s)	19, 256, 449
Bme18I	GGWCC	3 cut(s)	56, 153, 266
BmgT120I	GGNCC	4 cut(s)	56, 153, 266, 296
BmiI	GGNNCC	3 cut(s)	290, 298, 377
BmrFI	CCNGG	3 cut(s)	19, 256, 449
BpiI	GAAGAC	1 cut(s)	559
BpmI	CTGGAG	1 cut(s)	108
Bpu1102I	GCTNAGC	2 cut(s)	248, 453
BpuEI	CTTGAG	1 cut(s)	472
BsaJI	CCNNGG	6 cut(s)	17, 18, 254, 292, 447, 533
BsaWI	WCCGGW	2 cut(s)	155, 557
Bsc4I	CCNNNNNNNGG	2 cut(s)	18, 259
Bse1I	ACTGG	2 cut(s)	269, 511
Bse3DI	GCAATG	1 cut(s)	88
BseAI	TCCGGA	1 cut(s)	155
BseBI	CCWGG	3 cut(s)	19, 256, 449
BseDI	CCNNGG	6 cut(s)	17, 18, 254, 292, 447, 533
BseGI	GGATG	3 cut(s)	155, 193, 435
BseLI	CCNNNNNNNGG	2 cut(s)	18, 259
BseMI	GCAATG	1 cut(s)	88
BseMII	CTCAG	3 cut(s)	239, 317, 444
BseNI	ACTGG	2 cut(s)	269, 511
BseXI	GCAGC	1 cut(s)	467
BshFI	GGCC	1 cut(s)	297
BsiHKAI	GWGCWC	1 cut(s)	122
BsiSI	CCGG	2 cut(s)	156, 558
BslI	CCNNNNNNNGG	2 cut(s)	18, 259
BsmAI	GTCTC	1 cut(s)	194
BsnI	GGCC	1 cut(s)	297
Bsp1286I	GDGCHC	2 cut(s)	122, 254
Bsp13I	TCCGGA	1 cut(s)	155
Bsp143I	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
Bsp1720I	GCTNAGC	2 cut(s)	248, 453
Bsp19I	CCATGG	1 cut(s)	533
BspANI	GGCC	1 cut(s)	297
BspCNI	CTCAG	3 cut(s)	240, 316, 445
BspEI	TCCGGA	1 cut(s)	155
BspLI	GGNNCC	3 cut(s)	290, 298, 377
BspMAI	CTGCAG	1 cut(s)	316
BspPI	GGATC	4 cut(s)	370, 376, 383, 400
BsrDI	GCAATG	1 cut(s)	88
BsrI	ACTGG	2 cut(s)	269, 511
BssECI	CCNNGG	6 cut(s)	17, 18, 254, 292, 447, 533
BssMI	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
BssT1I	CCWWGG	2 cut(s)	292, 533
Bst2UI	CCWGG	3 cut(s)	19, 256, 449
Bst6I	CTCTTC	1 cut(s)	212
BstC8I	GCNNGC	3 cut(s)	79, 182, 245
BstDEI	CTNAG	3 cut(s)	248, 303, 453
BstDSI	CCRYGG	1 cut(s)	533
BstF5I	GGATG	3 cut(s)	155, 193, 435
BstKTI	GATC	6 cut(s)	105, 311, 371, 378, 408, 603
BstMAI	GTCTC	1 cut(s)	194
BstMBI	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
BstMWI	GCNNNNNNNGC	2 cut(s)	249, 288
BstNI	CCWGG	3 cut(s)	19, 256, 449
BstNSI	RCATGY	1 cut(s)	81
BstSCI	CCNGG	3 cut(s)	17, 254, 447
BstSFI	CTRYAG	1 cut(s)	312
BstV1I	GCAGC	1 cut(s)	467
BstV2I	GAAGAC	1 cut(s)	559
BstX2I	RGATCY	2 cut(s)	308, 375
BstYI	RGATCY	2 cut(s)	308, 375
BsuRI	GGCC	1 cut(s)	297
BtgI	CCRYGG	1 cut(s)	533
BtsCI	GGATG	3 cut(s)	155, 193, 435
BtsIMutI	CAGTG	1 cut(s)	122
Cac8I	GCNNGC	3 cut(s)	79, 182, 245
Cfr13I	GGNCC	4 cut(s)	56, 153, 266, 296
CviAII	CATG	4 cut(s)	78, 363, 534, 546
DdeI	CTNAG	3 cut(s)	248, 303, 453
DpnI	GATC	6 cut(s)	104, 310, 370, 377, 407, 602
DpnII	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
Eam1104I	CTCTTC	1 cut(s)	212
EarI	CTCTTC	1 cut(s)	212
Eco130I	CCWWGG	2 cut(s)	292, 533
Eco24I	GRGCYC	1 cut(s)	254
Eco47I	GGWCC	3 cut(s)	56, 153, 266
Eco57I	CTGAAG	1 cut(s)	9
EcoO109I	RGGNCCY	1 cut(s)	296
EcoRII	CCWGG	3 cut(s)	17, 254, 447
EcoT14I	CCWWGG	2 cut(s)	292, 533
EcoT38I	GRGCYC	1 cut(s)	254
ErhI	CCWWGG	2 cut(s)	292, 533
FaeI	CATG	4 cut(s)	81, 366, 537, 549
FaiI	YATR	8 cut(s)	79, 212, 327, 347, 364, 473, 535, 547
FatI	CATG	4 cut(s)	77, 362, 533, 545
Fnu4HI	GCNGC	1 cut(s)	481
FokI	GGATG	3 cut(s)	162, 180, 442
FriOI	GRGCYC	1 cut(s)	254
Fsp4HI	GCNGC	1 cut(s)	481
FspBI	CTAG	1 cut(s)	380
GluI	GCNGC	1 cut(s)	481
GsuI	CTGGAG	1 cut(s)	108
HaeIII	GGCC	1 cut(s)	297
HapII	CCGG	2 cut(s)	156, 558
Hin1II	CATG	4 cut(s)	81, 366, 537, 549
HincII	GTYRAC	1 cut(s)	469
HindII	GTYRAC	1 cut(s)	469
HindIII	AAGCTT	1 cut(s)	280
HinfI	GANTC	4 cut(s)	51, 68, 159, 550
HpaII	CCGG	2 cut(s)	156, 558
Hpy166II	GTNNAC	1 cut(s)	469
Hpy188I	TCNGA	4 cut(s)	28, 38, 56, 306
Hpy188III	TCNNGA	5 cut(s)	100, 125, 156, 276, 489
Hpy8I	GTNNAC	1 cut(s)	469
Hpy99I	CGWCG	1 cut(s)	143
HpyAV	CCTTC	1 cut(s)	257
HpyCH4V	TGCA	4 cut(s)	77, 81, 314, 545
HpyF10VI	GCNNNNNNNGC	2 cut(s)	249, 288
HpyF3I	CTNAG	3 cut(s)	248, 303, 453
Hsp92II	CATG	4 cut(s)	81, 366, 537, 549
Kpn2I	TCCGGA	1 cut(s)	155
Kzo9I	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
LmnI	GCTCC	2 cut(s)	9, 288
Lsp1109I	GCAGC	1 cut(s)	467
MaeI	CTAG	1 cut(s)	380
MaeIII	GTNAC	2 cut(s)	316, 441
MalI	GATC	6 cut(s)	104, 310, 370, 377, 407, 602
MboI	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
MboII	GAAGA	5 cut(s)	199, 445, 504, 512, 559
MflI	RGATCY	2 cut(s)	308, 375
MhlI	GDGCHC	2 cut(s)	122, 254
MluCI	AATT	7 cut(s)	44, 60, 111, 133, 330, 510, 528
MlyI	GAGTC	3 cut(s)	60, 62, 544
MmeI	TCCRAC	2 cut(s)	34, 240
MnlI	CCTC	3 cut(s)	17, 107, 496
MroI	TCCGGA	1 cut(s)	155
MseI	TTAA	1 cut(s)	587
MspI	CCGG	2 cut(s)	156, 558
MspR9I	CCNGG	3 cut(s)	19, 256, 449
MvaI	CCWGG	3 cut(s)	19, 256, 449
MwoI	GCNNNNNNNGC	2 cut(s)	249, 288
NcoI	CCATGG	1 cut(s)	533
NdeII	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
NlaIII	CATG	4 cut(s)	81, 366, 537, 549
NlaIV	GGNNCC	3 cut(s)	290, 298, 377
NspI	RCATGY	1 cut(s)	81
PaeI	GCATGC	1 cut(s)	81
PasI	CCCWGGG	1 cut(s)	18
PfeI	GAWTC	1 cut(s)	159
PflFI	GACNNNGTC	1 cut(s)	32
PkrI	GCNGC	1 cut(s)	482
PleI	GAGTC	3 cut(s)	59, 62, 544
PpsI	GAGTC	3 cut(s)	59, 62, 544
Psp6I	CCWGG	3 cut(s)	17, 254, 447
PspGI	CCWGG	3 cut(s)	17, 254, 447
PspN4I	GGNNCC	3 cut(s)	290, 298, 377
PspPI	GGNCC	4 cut(s)	56, 153, 266, 296
PstI	CTGCAG	1 cut(s)	316
PsuI	RGATCY	2 cut(s)	308, 375
PsyI	GACNNNGTC	1 cut(s)	32
SaqAI	TTAA	1 cut(s)	587
SatI	GCNGC	1 cut(s)	481
Sau3AI	GATC	6 cut(s)	102, 308, 368, 375, 405, 600
Sau96I	GGNCC	4 cut(s)	56, 153, 266, 296
SchI	GAGTC	3 cut(s)	60, 62, 544
ScrFI	CCNGG	3 cut(s)	19, 256, 449
SduI	GDGCHC	2 cut(s)	122, 254
SetI	ASST	9 cut(s)	99, 260, 268, 284, 385, 425, 459, 482, 576
SfcI	CTRYAG	1 cut(s)	312
SinI	GGWCC	3 cut(s)	56, 153, 266
SmlI	CTYRAG	1 cut(s)	487
SmoI	CTYRAG	1 cut(s)	487
SphI	GCATGC	1 cut(s)	81
Sse9I	AATT	7 cut(s)	44, 60, 111, 133, 330, 510, 528
SspMI	CTAG	1 cut(s)	380
StyD4I	CCNGG	3 cut(s)	17, 254, 447
StyI	CCWWGG	2 cut(s)	292, 533
TaqI	TCGA	2 cut(s)	101, 141
TasI	AATT	7 cut(s)	44, 60, 111, 133, 330, 510, 528
TfiI	GAWTC	1 cut(s)	159
Tru1I	TTAA	1 cut(s)	587
Tru9I	TTAA	1 cut(s)	587
TscAI	CASTG	1 cut(s)	122
TseI	GCWGC	1 cut(s)	480
TspDTI	ATGAA	2 cut(s)	199, 446
TspRI	CASTG	1 cut(s)	122
Tth111I	GACNNNGTC	1 cut(s)	32
VpaK11BI	GGWCC	3 cut(s)	56, 153, 266
XceI	RCATGY	1 cut(s)	81
XcmI	CCANNNNNNNNNTGG	1 cut(s)	455
XspI	CTAG	1 cut(s)	380

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.