Rh4CG195700

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
41836822 .. 41866052
29231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG195700.1

Sequence Viewer

Length: 441 bp
ATGGCAGATGCAGTACAACTGAATGAGGTCGTGTCAAAGATGGCAAAGGCATTGGTACTGAAAAAGGTATTTAAGGAATCTGAGTTTGATGCTGTACTTCCAGGAAGTGAAGTTCCGAAGTGGTTCAACAGCCGTGAGGACGAAGACTGTGTTCTTATGCGTGATTACTCTGATGAATATGAACTTTGGATAGAAATCCCTAGGAGTTTGAAATGGAAGGAAACAGGGTTTGTTGTTTGTGCTGTTTTTGATGTTTATTCTGGTGATTTTGCTTTTGGTCTCGACATTACAATCAATGAAGTTGACATGACTGCCGAAGACACGCATGATTCATCATGCCCACTGATATGTTCCTTTAAAGCAACAGTAACAGAACCATCAGCTCATGTTTGGTTGAGATATATTCCATTGAAGGTCGACATCAAGCAAGAGAGTGTATAA

Protein Analysis

146

Amino Acids

16.64

Weight (kDa)

4.5

Isoelectric Point (pI)

37.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 417
AfaI GTAC 3 cut(s) 15, 57, 96
AgsI TTSAA 3 cut(s) 127, 211, 412
AjnI CCWGG 1 cut(s) 100
AloI GAACNNNNNNTCC 2 cut(s) 96, 128
AluBI AGCT 1 cut(s) 383
AluI AGCT 1 cut(s) 383
Alw26I GTCTC 1 cut(s) 284
Asp700I GAANNNNTTC 1 cut(s) 122
AspA2I CCTAGG 1 cut(s) 200
AsuHPI GGTGA 1 cut(s) 275
AvrII CCTAGG 1 cut(s) 200
BbsI GAAGAC 2 cut(s) 150, 324
BccI CCATC 2 cut(s) 34, 385
BceAI ACGGC 1 cut(s) 117
BciT130I CCWGG 1 cut(s) 102
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 1 cut(s) 201
BlnI CCTAGG 1 cut(s) 200
Bme1390I CCNGG 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 102
BmsI GCATC 1 cut(s) 79
BpiI GAAGAC 2 cut(s) 150, 324
BsaBI GATNNNNATC 1 cut(s) 194
BsaI GGTCTC 1 cut(s) 284
BsaJI CCNNGG 1 cut(s) 200
Bse8I GATNNNNATC 1 cut(s) 194
BseBI CCWGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 200
BseJI GATNNNNATC 1 cut(s) 194
BseMII CTCAG 1 cut(s) 72
BsmAI GTCTC 1 cut(s) 284
Bso31I GGTCTC 1 cut(s) 284
BspCNI CTCAG 1 cut(s) 73
BspTNI GGTCTC 1 cut(s) 284
BssECI CCNNGG 1 cut(s) 200
BssT1I CCWWGG 1 cut(s) 200
Bst2UI CCWGG 1 cut(s) 102
Bst4CI ACNGT 2 cut(s) 149, 367
BstDEI CTNAG 1 cut(s) 81
BstMAI GTCTC 1 cut(s) 284
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstV2I GAAGAC 2 cut(s) 150, 324
BtsIMutI CAGTG 1 cut(s) 341
Csp6I GTAC 3 cut(s) 14, 56, 95
CviAII CATG 4 cut(s) 307, 326, 336, 386
CviJI RGCY 2 cut(s) 132, 383
CviKI_1 RGCY 2 cut(s) 132, 383
CviQI GTAC 3 cut(s) 14, 56, 95
DdeI CTNAG 1 cut(s) 81
DraI TTTAAA 1 cut(s) 358
Eco130I CCWWGG 1 cut(s) 200
Eco31I GGTCTC 1 cut(s) 284
EcoRII CCWGG 1 cut(s) 100
EcoT14I CCWWGG 1 cut(s) 200
ErhI CCWWGG 1 cut(s) 200
FaeI CATG 4 cut(s) 310, 329, 339, 389
FaiI YATR 9 cut(s) 158, 180, 308, 327, 337, 349, 387, 402, 439
FatI CATG 4 cut(s) 306, 325, 335, 385
FblI GTMKAC 1 cut(s) 417
FspBI CTAG 1 cut(s) 201
Hin1II CATG 4 cut(s) 310, 329, 339, 389
HincII GTYRAC 2 cut(s) 304, 418
HindII GTYRAC 2 cut(s) 304, 418
HinfI GANTC 2 cut(s) 77, 329
HphI GGTGA 1 cut(s) 275
Hpy166II GTNNAC 2 cut(s) 304, 418
Hpy188I TCNGA 3 cut(s) 82, 117, 172
Hpy188III TCNNGA 1 cut(s) 281
Hpy8I GTNNAC 2 cut(s) 304, 418
HpyAV CCTTC 2 cut(s) 211, 406
HpyCH4III ACNGT 2 cut(s) 149, 367
HpyCH4V TGCA 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 4 cut(s) 310, 329, 339, 389
LpnPI CCDG 4 cut(s) 87, 114, 210, 246
LweI GCATC 1 cut(s) 79
MaeI CTAG 1 cut(s) 201
MaeIII GTNAC 1 cut(s) 367
MboII GAAGA 2 cut(s) 155, 329
MnlI CCTC 2 cut(s) 19, 130
MroXI GAANNNNTTC 1 cut(s) 122
MseI TTAA 2 cut(s) 72, 357
MslI CAYNNNNRTG 1 cut(s) 346
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
NlaIII CATG 4 cut(s) 310, 329, 339, 389
PdmI GAANNNNTTC 1 cut(s) 122
PfeI GAWTC 2 cut(s) 77, 329
PfoI TCCNGGA 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
RsaI GTAC 3 cut(s) 15, 57, 96
RsaNI GTAC 3 cut(s) 14, 56, 95
RseI CAYNNNNRTG 1 cut(s) 346
SalI GTCGAC 1 cut(s) 416
SaqAI TTAA 2 cut(s) 72, 357
ScrFI CCNGG 1 cut(s) 102
SetI ASST 4 cut(s) 30, 69, 385, 417
SfaNI GCATC 1 cut(s) 79
SmiMI CAYNNNNRTG 1 cut(s) 346
SspMI CTAG 1 cut(s) 201
StyD4I CCNGG 1 cut(s) 100
StyI CCWWGG 1 cut(s) 200
TaaI ACNGT 2 cut(s) 149, 367
TaqI TCGA 2 cut(s) 282, 417
TatI WGTACW 2 cut(s) 13, 94
TfiI GAWTC 2 cut(s) 77, 329
Tru1I TTAA 2 cut(s) 72, 357
Tru9I TTAA 2 cut(s) 72, 357
TscAI CASTG 1 cut(s) 348
TspDTI ATGAA 4 cut(s) 189, 195, 312, 321
TspRI CASTG 1 cut(s) 348
XmaJI CCTAGG 1 cut(s) 200
XmiI GTMKAC 1 cut(s) 417
XmnI GAANNNNTTC 1 cut(s) 122
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.