Rw4G022300

Phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
47625890 .. 47627997
2108 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G022300.1

Sequence Viewer

Length: 309 bp
ATGCTACTCTCGTTGCCAAAAGGAAAATGCTTGCTGAGCCCCAGGTTGGAAGGTCCAGTTTCCAGAAGCTTTTGGAGCCAAGGCCCCACTCAGAGATCTGCAGTTACTCCTTATAGAATTGTTCTTGGTAATATAAAAGACAAGCAATCATGTGGATCAGGGATCCTAGCTGATGGTCGGCTTGATGATTTGATCCAAAGAGTTGCTACCTTTGGGATGGTATTAATGAAAGCTCGACTTGCGTCAGGTGTGCTTTTATTTTATAGAAGAAGTTACTACCCCAGGCTGAGCTTGGCTTCGTCAACATAG

Protein Analysis

102

Amino Acids

11.23

Weight (kDa)

10.48

Isoelectric Point (pI)

53.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 157, 163, 170, 187
AfiI CCNNNNNNNGG 1 cut(s) 46
AjnI CCWGG 2 cut(s) 41, 281
AluBI AGCT 4 cut(s) 69, 170, 233, 291
AluI AGCT 4 cut(s) 69, 170, 233, 291
AlwI GGATC 4 cut(s) 157, 163, 170, 187
AoxI GGCC 1 cut(s) 82
AseI ATTAAT 1 cut(s) 224
AspS9I GGNCC 2 cut(s) 53, 83
AvaII GGWCC 1 cut(s) 53
BamHI GGATCC 1 cut(s) 162
BanII GRGCYC 1 cut(s) 41
BccI CCATC 2 cut(s) 167, 211
BciT130I CCWGG 2 cut(s) 43, 283
BfaI CTAG 1 cut(s) 167
BfmI CTRYAG 1 cut(s) 99
BglII AGATCT 1 cut(s) 95
BlpI GCTNAGC 2 cut(s) 35, 287
Bme1390I CCNGG 2 cut(s) 43, 283
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 2 cut(s) 53, 83
BmiI GGNNCC 3 cut(s) 77, 85, 164
BmrFI CCNGG 2 cut(s) 43, 283
BoxI GACNNNNGTC 1 cut(s) 241
Bpu1102I GCTNAGC 2 cut(s) 35, 287
BsaJI CCNNGG 3 cut(s) 41, 79, 281
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse1I ACTGG 1 cut(s) 56
BseBI CCWGG 2 cut(s) 43, 283
BseDI CCNNGG 3 cut(s) 41, 79, 281
BseGI GGATG 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMII CTCAG 3 cut(s) 26, 104, 278
BseNI ACTGG 1 cut(s) 56
BshFI GGCC 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 46
BsnI GGCC 1 cut(s) 84
Bsp1286I GDGCHC 1 cut(s) 41
Bsp143I GATC 4 cut(s) 95, 155, 162, 192
Bsp1720I GCTNAGC 2 cut(s) 35, 287
BspANI GGCC 1 cut(s) 84
BspCNI CTCAG 3 cut(s) 27, 103, 279
BspLI GGNNCC 3 cut(s) 77, 85, 164
BspMAI CTGCAG 1 cut(s) 103
BspPI GGATC 4 cut(s) 157, 163, 170, 187
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 3 cut(s) 41, 79, 281
BssMI GATC 4 cut(s) 95, 155, 162, 192
BssT1I CCWWGG 1 cut(s) 79
Bst2UI CCWGG 2 cut(s) 43, 283
BstC8I GCNNGC 1 cut(s) 32
BstDEI CTNAG 3 cut(s) 35, 90, 287
BstF5I GGATG 1 cut(s) 222
BstKTI GATC 4 cut(s) 98, 158, 165, 195
BstMBI GATC 4 cut(s) 95, 155, 162, 192
BstMWI GCNNNNNNNGC 3 cut(s) 36, 75, 239
BstNI CCWGG 2 cut(s) 43, 283
BstPAI GACNNNNGTC 1 cut(s) 241
BstSCI CCNGG 2 cut(s) 41, 281
BstSFI CTRYAG 1 cut(s) 99
BstX2I RGATCY 2 cut(s) 95, 162
BstYI RGATCY 2 cut(s) 95, 162
BsuRI GGCC 1 cut(s) 84
BtsCI GGATG 1 cut(s) 222
Cac8I GCNNGC 1 cut(s) 32
Cfr13I GGNCC 2 cut(s) 53, 83
CseI GACGC 1 cut(s) 231
CviAII CATG 1 cut(s) 150
DdeI CTNAG 3 cut(s) 35, 90, 287
DpnI GATC 4 cut(s) 97, 157, 164, 194
DpnII GATC 4 cut(s) 95, 155, 162, 192
Eco130I CCWWGG 1 cut(s) 79
Eco24I GRGCYC 1 cut(s) 41
Eco47I GGWCC 1 cut(s) 53
EcoO109I RGGNCCY 1 cut(s) 83
EcoRII CCWGG 2 cut(s) 41, 281
EcoT14I CCWWGG 1 cut(s) 79
EcoT38I GRGCYC 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 153
FaiI YATR 5 cut(s) 114, 134, 151, 264, 307
FalI AAGNNNNNCTT 2 cut(s) 222, 254
FatI CATG 1 cut(s) 149
FokI GGATG 1 cut(s) 229
FriOI GRGCYC 1 cut(s) 41
FspBI CTAG 1 cut(s) 167
HaeIII GGCC 1 cut(s) 84
HgaI GACGC 1 cut(s) 231
Hin1II CATG 1 cut(s) 153
HincII GTYRAC 1 cut(s) 303
HindII GTYRAC 1 cut(s) 303
HindIII AAGCTT 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 303
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 303
HpyAV CCTTC 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 101
HpyF10VI GCNNNNNNNGC 3 cut(s) 36, 75, 239
HpyF3I CTNAG 3 cut(s) 35, 90, 287
Hsp92II CATG 1 cut(s) 153
Kzo9I GATC 4 cut(s) 95, 155, 162, 192
LmnI GCTCC 1 cut(s) 75
LpnPI CCDG 8 cut(s) 28, 55, 69, 76, 144, 231, 268, 295
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 2 cut(s) 103, 272
MalI GATC 4 cut(s) 97, 157, 164, 194
MboI GATC 4 cut(s) 95, 155, 162, 192
MboII GAAGA 1 cut(s) 279
MflI RGATCY 2 cut(s) 95, 162
MhlI GDGCHC 1 cut(s) 41
MluCI AATT 1 cut(s) 117
MmeI TCCRAC 1 cut(s) 27
MseI TTAA 1 cut(s) 224
MspR9I CCNGG 2 cut(s) 43, 283
MvaI CCWGG 2 cut(s) 43, 283
MwoI GCNNNNNNNGC 3 cut(s) 36, 75, 239
NdeII GATC 4 cut(s) 95, 155, 162, 192
NlaIII CATG 1 cut(s) 153
NlaIV GGNNCC 3 cut(s) 77, 85, 164
PshAI GACNNNNGTC 1 cut(s) 241
PshBI ATTAAT 1 cut(s) 224
Psp6I CCWGG 2 cut(s) 41, 281
PspGI CCWGG 2 cut(s) 41, 281
PspN4I GGNNCC 3 cut(s) 77, 85, 164
PspPI GGNCC 2 cut(s) 53, 83
PstI CTGCAG 1 cut(s) 103
PsuI RGATCY 2 cut(s) 95, 162
SaqAI TTAA 1 cut(s) 224
Sau3AI GATC 4 cut(s) 95, 155, 162, 192
Sau96I GGNCC 2 cut(s) 53, 83
ScrFI CCNGG 2 cut(s) 43, 283
SduI GDGCHC 1 cut(s) 41
SetI ASST 8 cut(s) 47, 55, 71, 172, 212, 235, 250, 293
SfcI CTRYAG 1 cut(s) 99
SinI GGWCC 1 cut(s) 53
Sse9I AATT 1 cut(s) 117
SspMI CTAG 1 cut(s) 167
StyD4I CCNGG 2 cut(s) 41, 281
StyI CCWWGG 1 cut(s) 79
TaqI TCGA 1 cut(s) 235
TasI AATT 1 cut(s) 117
Tru1I TTAA 1 cut(s) 224
Tru9I TTAA 1 cut(s) 224
TspDTI ATGAA 1 cut(s) 242
VpaK11BI GGWCC 1 cut(s) 53
VspI ATTAAT 1 cut(s) 224
XcmI CCANNNNNNNNNTGG 1 cut(s) 289
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.