RchiOBHm_Chr5g0016231

Phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
11219106 .. 11221806
2701 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29662

Sequence Viewer

Length: 177 bp
ATGTTTGCTGAGTCCCAGGTTGGAAGTTCCAGTTTCCATAAGCTTTTGGAGCCAAAGCCCACTCAGAGATCTGCAATTACTCCTTATAGAATTGTTCTTGGTAATATAAAAAGACAAGCTTATGAAGACACGAAGACAATTGGAGCTTCTTCTAGAGGATCTTCCTTGCGATTTTAA

Protein Analysis

58

Amino Acids

6.44

Weight (kDa)

10.27

Isoelectric Point (pI)

50.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 166
AjnI CCWGG 1 cut(s) 15
AluBI AGCT 3 cut(s) 43, 119, 146
AluI AGCT 3 cut(s) 43, 119, 146
AlwI GGATC 1 cut(s) 166
BbsI GAAGAC 2 cut(s) 132, 140
BciT130I CCWGG 1 cut(s) 17
BfaI CTAG 1 cut(s) 153
BglII AGATCT 1 cut(s) 68
Bme1390I CCNGG 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 17
BpiI GAAGAC 2 cut(s) 132, 140
BsaJI CCNNGG 1 cut(s) 15
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 15
BseMII CTCAG 1 cut(s) 77
BseNI ACTGG 1 cut(s) 30
Bsp143I GATC 2 cut(s) 68, 158
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 51
BspPI GGATC 1 cut(s) 166
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 2 cut(s) 68, 158
Bst2UI CCWGG 1 cut(s) 17
BstDEI CTNAG 2 cut(s) 9, 63
BstKTI GATC 2 cut(s) 71, 161
BstMBI GATC 2 cut(s) 68, 158
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 17
BstSCI CCNGG 1 cut(s) 15
BstV2I GAAGAC 2 cut(s) 132, 140
BstX2I RGATCY 2 cut(s) 68, 158
BstYI RGATCY 2 cut(s) 68, 158
CviJI RGCY 5 cut(s) 43, 52, 58, 119, 146
CviKI_1 RGCY 5 cut(s) 43, 52, 58, 119, 146
DdeI CTNAG 2 cut(s) 9, 63
DpnI GATC 2 cut(s) 70, 160
DpnII GATC 2 cut(s) 68, 158
EcoRII CCWGG 1 cut(s) 15
FaiI YATR 4 cut(s) 39, 87, 107, 123
FalI AAGNNNNNCTT 2 cut(s) 103, 135
FspBI CTAG 1 cut(s) 153
HindIII AAGCTT 2 cut(s) 41, 117
HinfI GANTC 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 1 cut(s) 153
HpyCH4V TGCA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 2 cut(s) 9, 63
Kzo9I GATC 2 cut(s) 68, 158
LmnI GCTCC 2 cut(s) 49, 143
LpnPI CCDG 3 cut(s) 2, 29, 43
MaeI CTAG 1 cut(s) 153
MalI GATC 2 cut(s) 70, 160
MboI GATC 2 cut(s) 68, 158
MboII GAAGA 4 cut(s) 137, 141, 145, 153
MfeI CAATTG 1 cut(s) 138
MflI RGATCY 2 cut(s) 68, 158
MluCI AATT 3 cut(s) 75, 90, 138
MlyI GAGTC 1 cut(s) 20
MnlI CCTC 1 cut(s) 149
MseI TTAA 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 17
MunI CAATTG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 17
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 2 cut(s) 68, 158
NlaIV GGNNCC 1 cut(s) 51
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
PspN4I GGNNCC 1 cut(s) 51
PsuI RGATCY 2 cut(s) 68, 158
SaqAI TTAA 1 cut(s) 175
Sau3AI GATC 2 cut(s) 68, 158
SchI GAGTC 1 cut(s) 20
ScrFI CCNGG 1 cut(s) 17
SetI ASST 4 cut(s) 21, 45, 121, 148
SgeI CNNG 7 cut(s) 28, 29, 42, 110, 128, 142, 165
Sse9I AATT 3 cut(s) 75, 90, 138
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 15
TasI AATT 3 cut(s) 75, 90, 138
Tru1I TTAA 1 cut(s) 175
Tru9I TTAA 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 138
XbaI TCTAGA 1 cut(s) 152
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.