RchiOBHm_Chr1g0343991

Nucleoside diphosphate kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
36378774 .. 36388463
9690 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGTACTTTCAAACTAGGTGGAAAACACTACCAAGAGAACCTCCTCCACTTGATGATACTGATGTTGATGATTGGCTTCCATGCGTTGTTGTCTTGCAAGGGACCTGCATGTTCTTCTACTTGTTATCTACAGAATTCTTCCCCTTTGCATTTGTAATAGTAGATTTCAAAAATCATGTGAACTTGGATATTGAAGCCTCCATTGACCAAGAGATCATTCGGCGAACCAAGAAATGTTGA

Protein Analysis

79

Amino Acids

9.4

Weight (kDa)

4.68

Isoelectric Point (pI)

57.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 113
AcsI RAATTY 1 cut(s) 134
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 3 cut(s) 11, 169, 194
AjuI GAANNNNNNNTTGG 2 cut(s) 201, 233
ApoI RAATTY 1 cut(s) 134
AspS9I GGNCC 1 cut(s) 102
AvaII GGWCC 1 cut(s) 102
BaeI ACNNNNGTAYC 2 cut(s) 48, 81
BfaI CTAG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 129
BfuAI ACCTGC 1 cut(s) 113
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 102
BmiI GGNNCC 1 cut(s) 103
BseRI GAGGAG 1 cut(s) 33
BslFI GGGAC 1 cut(s) 115
BsmFI GGGAC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 213
BspLI GGNNCC 1 cut(s) 103
BspMI ACCTGC 1 cut(s) 113
BssMI GATC 1 cut(s) 213
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstNSI RCATGY 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 129
BveI ACCTGC 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 102
Csp6I GTAC 1 cut(s) 4
CspCI CAANNNNNGTGG 1 cut(s) 34
CviAII CATG 3 cut(s) 81, 109, 176
CviJI RGCY 2 cut(s) 76, 197
CviKI_1 RGCY 2 cut(s) 76, 197
CviQI GTAC 1 cut(s) 4
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 102
EcoO109I RGGNCCY 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 134
FaeI CATG 3 cut(s) 84, 112, 179
FaiI YATR 3 cut(s) 82, 110, 177
FaqI GGGAC 1 cut(s) 115
FatI CATG 3 cut(s) 80, 108, 175
FspBI CTAG 1 cut(s) 15
Hin1II CATG 3 cut(s) 84, 112, 179
Hpy166II GTNNAC 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 97, 108, 149
Hsp92II CATG 3 cut(s) 84, 112, 179
Kzo9I GATC 1 cut(s) 213
LpnPI CCDG 1 cut(s) 118
MaeI CTAG 1 cut(s) 15
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MboII GAAGA 2 cut(s) 106, 130
MluCI AATT 1 cut(s) 134
MnlI CCTC 3 cut(s) 51, 54, 208
NdeII GATC 1 cut(s) 213
NlaIII CATG 3 cut(s) 84, 112, 179
NlaIV GGNNCC 1 cut(s) 103
NspI RCATGY 1 cut(s) 112
PpuMI RGGWCCY 1 cut(s) 102
Psp5II RGGWCCY 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 102
PspPPI RGGWCCY 1 cut(s) 102
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
Sau3AI GATC 1 cut(s) 213
Sau96I GGNCC 1 cut(s) 102
SetI ASST 3 cut(s) 20, 43, 107
SfcI CTRYAG 1 cut(s) 129
SinI GGWCC 1 cut(s) 102
Sse9I AATT 1 cut(s) 134
SspMI CTAG 1 cut(s) 15
TasI AATT 1 cut(s) 134
TatI WGTACW 1 cut(s) 3
VpaK11BI GGWCC 1 cut(s) 102
XapI RAATTY 1 cut(s) 134
XceI RCATGY 1 cut(s) 112
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.