Rh7DG146600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001166
Physical Location & Seq
Reverse (-)
12556380 .. 12556687
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG146600.1

Sequence Viewer

Length: 174 bp
ATGACGAAGAGCTCTAGGACGACGTCGTCTCGGAAGCAGAGCCAGCACAGTTCAAGCAACTCGGACTCGGAGGTAGAAATAGTTGATGACGATGAAAGAGAAGGGAGGACAAGGAAGGCCAAGAAGTGTAAAGAGGAGTGTTCCGTCAAGGTTTCTTACGCTGGCGAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.41

Weight (kDa)

8.66

Isoelectric Point (pI)

65.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 25
AatII GACGTC 1 cut(s) 26
AcyI GRCGYC 1 cut(s) 23
AgsI TTSAA 1 cut(s) 54
AluBI AGCT 1 cut(s) 12
AluI AGCT 1 cut(s) 12
Alw21I GWGCWC 1 cut(s) 14
Alw26I GTCTC 1 cut(s) 33
AoxI GGCC 1 cut(s) 117
BanII GRGCYC 1 cut(s) 14
Bbv12I GWGCWC 1 cut(s) 14
BcoDI GTCTC 1 cut(s) 33
BfaI CTAG 1 cut(s) 15
BsaHI GRCGYC 1 cut(s) 23
BseRI GAGGAG 1 cut(s) 149
BshFI GGCC 1 cut(s) 119
BsiHKAI GWGCWC 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 33
BsmBI CGTCTC 1 cut(s) 33
BsnI GGCC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 14
BspANI GGCC 1 cut(s) 119
BspQI GCTCTTC 1 cut(s) 2
BssNI GRCGYC 1 cut(s) 23
Bst4CI ACNGT 1 cut(s) 50
Bst6I CTCTTC 1 cut(s) 2
BstACI GRCGYC 1 cut(s) 23
BstC8I GCNNGC 2 cut(s) 44, 163
BstMAI GTCTC 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 43
BsuRI GGCC 1 cut(s) 119
Cac8I GCNNGC 2 cut(s) 44, 163
CviJI RGCY 3 cut(s) 12, 42, 119
CviKI_1 RGCY 3 cut(s) 12, 42, 119
DrdI GACNNNNNNGTC 1 cut(s) 25
DseDI GACNNNNNNGTC 1 cut(s) 25
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
Ecl136II GAGCTC 1 cut(s) 12
Eco24I GRGCYC 1 cut(s) 14
Eco53kI GAGCTC 1 cut(s) 12
EcoICRI GAGCTC 1 cut(s) 12
EcoT38I GRGCYC 1 cut(s) 14
Esp3I CGTCTC 1 cut(s) 33
FriOI GRGCYC 1 cut(s) 14
FspBI CTAG 1 cut(s) 15
HaeIII GGCC 1 cut(s) 119
Hin1I GRCGYC 1 cut(s) 23
HinfI GANTC 1 cut(s) 65
Hpy188I TCNGA 3 cut(s) 33, 64, 70
Hpy99I CGWCG 2 cut(s) 25, 28
HpyAV CCTTC 2 cut(s) 95, 109
HpyCH4III ACNGT 1 cut(s) 50
HpyCH4IV ACGT 1 cut(s) 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
HpySE526I ACGT 1 cut(s) 23
Hsp92I GRCGYC 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 2
LpnPI CCDG 2 cut(s) 56, 147
MaeI CTAG 1 cut(s) 15
MaeII ACGT 1 cut(s) 23
MboII GAAGA 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 14
MlyI GAGTC 1 cut(s) 59
MnlI CCTC 3 cut(s) 64, 99, 127
MwoI GCNNNNNNNGC 1 cut(s) 43
PciSI GCTCTTC 1 cut(s) 2
PflFI GACNNNGTC 2 cut(s) 22, 25
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
Psp124BI GAGCTC 1 cut(s) 14
PsyI GACNNNGTC 2 cut(s) 22, 25
SacI GAGCTC 1 cut(s) 14
SapI GCTCTTC 1 cut(s) 2
SchI GAGTC 1 cut(s) 59
SduI GDGCHC 1 cut(s) 14
SetI ASST 4 cut(s) 14, 26, 75, 153
SgeI CNNG 9 cut(s) 27, 42, 55, 66, 73, 79, 123, 133, 160
SspMI CTAG 1 cut(s) 15
SstI GAGCTC 1 cut(s) 14
TaaI ACNGT 1 cut(s) 50
TaiI ACGT 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 108
TspGWI ACGGA 1 cut(s) 133
Tth111I GACNNNGTC 2 cut(s) 22, 25
XspI CTAG 1 cut(s) 15
ZraI GACGTC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.