Rmu_sc0008861.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008861.1
Physical Location & Seq
Reverse (-)
6822 .. 8383
1562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008861.1_g000002.1.cds

Sequence Viewer

Length: 897 bp
atgatagagctagaggatcaagcatatagcagatccagaagtaccaaggaacaacatgttgatcctgaaaagaatgatggagggtacactaggtataatgatgataggggaaatagagcttatgatagagaggaccgaagctatagtagatcccgaagtaccaaggaacaacattttgatctagaaaagaaagttagtggcatgacagagcctattcctgataaggaagggtctcgtttacaccatgctgatgcagactcaaatgcaagctgtaacagccagaggaattcacctagctcttattctcatctttcaaaagatcaatccaggccttcagtccaagcagaattaaagtatggggaacctaaagaaagagtaaggcaaaatttccttccctcaatagaggttgtagatgtttctggagttcttgaacagccttgtttgtataagctcaccaagagactaattgacaaggatgacagtaggttcggtgacttatcagttgagaggaatttaatttctgatgagtccaagccctccacttctcttatgaatctacctaataattctaagttgacaagatctactggggaaaactatgatagaaaaacatatggaagagtagtggtgtcaaggatatcggttcatcttgtgctgaaggaaagggaagttggcagttaccttccaagaagattccaggaagatagtgatgttttctcttcttcatcttctattaatgctggtcaagtacctagcaacttatactccaattttcatcgaccacacaatcattacaagagggctaatcgtcctaatgctggaccaatacatggtaatgccagcaaaggtgttccaaatcggccttctccactcgagagcaacttcactcatttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

298

Amino Acids

33.93

Weight (kDa)

8.87

Isoelectric Point (pI)

56.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 830
AclWI GGATC 4 cut(s) 24, 27, 56, 144
AcsI RAATTY 3 cut(s) 286, 385, 511
AcuI CTGAAG 2 cut(s) 318, 677
AfaI GTAC 4 cut(s) 43, 86, 160, 750
AfiI CCNNNNNNNGG 2 cut(s) 818, 830
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 2 cut(s) 315, 431
AjnI CCWGG 2 cut(s) 326, 696
AjuI GAANNNNNNNTTGG 4 cut(s) 654, 686, 847, 879
AluBI AGCT 6 cut(s) 10, 119, 141, 270, 297, 451
AluI AGCT 6 cut(s) 10, 119, 141, 270, 297, 451
Alw26I GTCTC 2 cut(s) 237, 454
AlwI GGATC 4 cut(s) 24, 27, 56, 144
Ama87I CYCGRG 1 cut(s) 872
AoxI GGCC 2 cut(s) 329, 860
ApoI RAATTY 3 cut(s) 286, 385, 511
ArsI GACNNNNNNTTYG 2 cut(s) 470, 502
AseI ATTAAT 1 cut(s) 735
AspS9I GGNCC 2 cut(s) 133, 821
AsuHPI GGTGA 3 cut(s) 282, 445, 503
AvaI CYCGRG 1 cut(s) 872
AvaII GGWCC 2 cut(s) 133, 821
BccI CCATC 1 cut(s) 71
BciT130I CCWGG 2 cut(s) 328, 698
BcoDI GTCTC 2 cut(s) 237, 454
BfaI CTAG 6 cut(s) 11, 90, 182, 294, 753, 895
BfmI CTRYAG 1 cut(s) 142
BglII AGATCT 1 cut(s) 581
Bme1390I CCNGG 2 cut(s) 328, 698
Bme18I GGWCC 2 cut(s) 133, 821
BmeT110I CYCGRG 1 cut(s) 872
BmgT120I GGNCC 2 cut(s) 133, 821
BmiI GGNNCC 1 cut(s) 363
BmrFI CCNGG 2 cut(s) 328, 698
BmrI ACTGGG 1 cut(s) 597
BmsI GCATC 1 cut(s) 241
BmuI ACTGGG 1 cut(s) 597
BpmI CTGGAG 1 cut(s) 441
BsaI GGTCTC 1 cut(s) 237
BsaJI CCNNGG 2 cut(s) 45, 162
BsaXI ACNNNNNCTCC 2 cut(s) 749, 779
Bsc4I CCNNNNNNNGG 2 cut(s) 818, 830
Bse1I ACTGG 1 cut(s) 592
BseBI CCWGG 2 cut(s) 328, 698
BseDI CCNNGG 2 cut(s) 45, 162
BseGI GGATG 1 cut(s) 481
BseLI CCNNNNNNNGG 2 cut(s) 818, 830
BseNI ACTGG 1 cut(s) 592
BshFI GGCC 2 cut(s) 331, 862
BsiHKCI CYCGRG 1 cut(s) 872
BslI CCNNNNNNNGG 2 cut(s) 818, 830
BsmAI GTCTC 2 cut(s) 237, 454
BsnI GGCC 2 cut(s) 331, 862
Bso31I GGTCTC 1 cut(s) 237
BsoBI CYCGRG 1 cut(s) 872
Bsp143I GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
BspANI GGCC 2 cut(s) 331, 862
BspLI GGNNCC 1 cut(s) 363
BspPI GGATC 4 cut(s) 24, 27, 56, 144
BspTNI GGTCTC 1 cut(s) 237
BsrI ACTGG 1 cut(s) 592
BssECI CCNNGG 2 cut(s) 45, 162
BssMI GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
BssT1I CCWWGG 2 cut(s) 45, 162
Bst2UI CCWGG 2 cut(s) 328, 698
Bst4CI ACNGT 1 cut(s) 482
Bst6I CTCTTC 2 cut(s) 613, 724
BstC8I GCNNGC 2 cut(s) 268, 841
BstDEI CTNAG 1 cut(s) 570
BstF5I GGATG 1 cut(s) 481
BstKTI GATC 7 cut(s) 19, 35, 64, 152, 181, 322, 584
BstMAI GTCTC 2 cut(s) 237, 454
BstMBI GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
BstMWI GCNNNNNNNGC 1 cut(s) 276
BstNI CCWGG 2 cut(s) 328, 698
BstNSI RCATGY 1 cut(s) 59
BstSCI CCNGG 2 cut(s) 326, 696
BstSFI CTRYAG 1 cut(s) 142
BstX2I RGATCY 3 cut(s) 32, 149, 581
BstYI RGATCY 3 cut(s) 32, 149, 581
BsuRI GGCC 2 cut(s) 331, 862
BtsCI GGATG 1 cut(s) 481
Cac8I GCNNGC 2 cut(s) 268, 841
Cfr13I GGNCC 2 cut(s) 133, 821
Csp6I GTAC 4 cut(s) 42, 85, 159, 749
CviAII CATG 4 cut(s) 56, 202, 245, 830
CviQI GTAC 4 cut(s) 42, 85, 159, 749
DdeI CTNAG 1 cut(s) 570
DpnI GATC 7 cut(s) 18, 34, 63, 151, 180, 321, 583
DpnII GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
Eam1104I CTCTTC 2 cut(s) 613, 724
EarI CTCTTC 2 cut(s) 613, 724
Eco130I CCWWGG 2 cut(s) 45, 162
Eco147I AGGCCT 1 cut(s) 331
Eco31I GGTCTC 1 cut(s) 237
Eco32I GATATC 1 cut(s) 639
Eco47I GGWCC 2 cut(s) 133, 821
Eco57I CTGAAG 2 cut(s) 318, 677
Eco88I CYCGRG 1 cut(s) 872
EcoRI GAATTC 1 cut(s) 286
EcoRII CCWGG 2 cut(s) 326, 696
EcoRV GATATC 1 cut(s) 639
EcoT14I CCWWGG 2 cut(s) 45, 162
ErhI CCWWGG 2 cut(s) 45, 162
FaeI CATG 4 cut(s) 59, 205, 248, 833
FatI CATG 4 cut(s) 55, 201, 244, 829
FauNDI CATATG 1 cut(s) 613
FokI GGATG 1 cut(s) 488
FspBI CTAG 6 cut(s) 11, 90, 182, 294, 753, 895
GsuI CTGGAG 1 cut(s) 441
HaeIII GGCC 2 cut(s) 331, 862
Hin1II CATG 4 cut(s) 59, 205, 248, 833
HincII GTYRAC 1 cut(s) 576
HindII GTYRAC 1 cut(s) 576
HinfI GANTC 4 cut(s) 257, 527, 553, 693
HphI GGTGA 3 cut(s) 282, 445, 503
Hpy166II GTNNAC 3 cut(s) 87, 239, 576
Hpy188I TCNGA 1 cut(s) 523
Hpy188III TCNNGA 8 cut(s) 36, 65, 153, 182, 218, 420, 428, 874
Hpy8I GTNNAC 3 cut(s) 87, 239, 576
HpyAV CCTTC 6 cut(s) 221, 342, 401, 652, 692, 873
HpyCH4III ACNGT 1 cut(s) 482
HpyCH4V TGCA 2 cut(s) 254, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 276
HpyF3I CTNAG 1 cut(s) 570
Hsp92II CATG 4 cut(s) 59, 205, 248, 833
Kzo9I GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
LweI GCATC 1 cut(s) 241
MaeI CTAG 6 cut(s) 11, 90, 182, 294, 753, 895
MaeIII GTNAC 3 cut(s) 272, 491, 677
MalI GATC 7 cut(s) 18, 34, 63, 151, 180, 321, 583
MboI GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
MboII GAAGA 6 cut(s) 630, 702, 711, 713, 714, 720
MflI RGATCY 3 cut(s) 32, 149, 581
MluCI AATT 8 cut(s) 286, 347, 385, 465, 511, 516, 565, 769
MlyI GAGTC 2 cut(s) 251, 536
MnlI CCTC 9 cut(s) 7, 74, 124, 276, 397, 406, 501, 547, 792
MseI TTAA 3 cut(s) 350, 515, 735
MslI CAYNNNNRTG 2 cut(s) 249, 834
MspR9I CCNGG 2 cut(s) 328, 698
MvaI CCWGG 2 cut(s) 328, 698
MwoI GCNNNNNNNGC 1 cut(s) 276
NdeI CATATG 1 cut(s) 613
NdeII GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
NlaIII CATG 4 cut(s) 59, 205, 248, 833
NlaIV GGNNCC 1 cut(s) 363
NmuCI GTSAC 1 cut(s) 491
NspI RCATGY 1 cut(s) 59
PaeR7I CTCGAG 1 cut(s) 872
PceI AGGCCT 1 cut(s) 331
PciI ACATGT 1 cut(s) 55
PfeI GAWTC 2 cut(s) 553, 693
PflMI CCANNNNNTGG 1 cut(s) 830
PfoI TCCNGGA 1 cut(s) 696
PleI GAGTC 2 cut(s) 251, 535
PpsI GAGTC 2 cut(s) 251, 535
PscI ACATGT 1 cut(s) 55
PshBI ATTAAT 1 cut(s) 735
Psp6I CCWGG 2 cut(s) 326, 696
PspGI CCWGG 2 cut(s) 326, 696
PspN4I GGNNCC 1 cut(s) 363
PspPI GGNCC 2 cut(s) 133, 821
PsuI RGATCY 3 cut(s) 32, 149, 581
RsaI GTAC 4 cut(s) 43, 86, 160, 750
RsaNI GTAC 4 cut(s) 42, 85, 159, 749
RseI CAYNNNNRTG 2 cut(s) 249, 834
SaqAI TTAA 3 cut(s) 350, 515, 735
Sau3AI GATC 7 cut(s) 16, 32, 61, 149, 178, 319, 581
Sau96I GGNCC 2 cut(s) 133, 821
SchI GAGTC 2 cut(s) 251, 536
ScrFI CCNGG 2 cut(s) 328, 698
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 142
Sfr274I CTCGAG 1 cut(s) 872
SinI GGWCC 2 cut(s) 133, 821
SlaI CTCGAG 1 cut(s) 872
SmiMI CAYNNNNRTG 2 cut(s) 249, 834
SmlI CTYRAG 1 cut(s) 872
SmoI CTYRAG 1 cut(s) 872
Sse9I AATT 8 cut(s) 286, 347, 385, 465, 511, 516, 565, 769
SseBI AGGCCT 1 cut(s) 331
SspMI CTAG 6 cut(s) 11, 90, 182, 294, 753, 895
StuI AGGCCT 1 cut(s) 331
StyD4I CCNGG 2 cut(s) 326, 696
StyI CCWWGG 2 cut(s) 45, 162
TaaI ACNGT 1 cut(s) 482
TaqI TCGA 2 cut(s) 778, 873
TaqII GACCGA 1 cut(s) 150
TasI AATT 8 cut(s) 286, 347, 385, 465, 511, 516, 565, 769
TfiI GAWTC 2 cut(s) 553, 693
Tru1I TTAA 3 cut(s) 350, 515, 735
Tru9I TTAA 3 cut(s) 350, 515, 735
TseFI GTSAC 1 cut(s) 491
Tsp45I GTSAC 1 cut(s) 491
TspDTI ATGAA 4 cut(s) 566, 635, 714, 764
Van91I CCANNNNNTGG 1 cut(s) 830
VpaK11BI GGWCC 2 cut(s) 133, 821
VspI ATTAAT 1 cut(s) 735
XapI RAATTY 3 cut(s) 286, 385, 511
XbaI TCTAGA 1 cut(s) 181
XceI RCATGY 1 cut(s) 59
XhoI CTCGAG 1 cut(s) 872
XspI CTAG 6 cut(s) 11, 90, 182, 294, 753, 895
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.