Rh7DG146400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
12552212 .. 12553599
1388 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG146400.1

Sequence Viewer

Length: 840 bp
ATGATAGGAGAAATAGAGCTGATGATAGAGCTAGAGGATCAAGCCTATAGCAAATCCAGAAGTACCACGGAACAACATGTTGATCCTGAAAAGAATGATGGAAATAGTTATAAGGATGATAGGGGAAATAGTGTTGATGATAGAGAGGACCAAAACTATAGCAGATCCCGAAGTACTAAGGAACGACATGTTGATCTAAAAAAGAATGCTGGAGAATTCACTAGGTATAATGATGATAGGGGAAATAGAGCTTATGATAGAGAGGACCGAAGCTATAGTAGATCCCGAAGTACCAAGGAACAACATTTTGATCTAGAAAAGAAAGTTAGTGGCATGACAGAGCCTATTGCTGATAAGGAATGGTCTCGTTTACACCATGCTGATGCAGACTCAAATGCAAGCTGTAACAGACAGAGGAATTCACCTAGCTCTTATTCTCATCTTTCAAAAGATCAATCCAGGCCCTCAGTCCAAGCAGAATTAAAGTATGGGGAACCTAAAGAAAGAGTAAGGCAAAATTTCCTTCCCTTAATAGAGGTTGTAGATGTTTCTAGAGTTCTTGAACAGCCTTGTTTGTATAAGCTCACCAAGAGACTAATTGACAAGGATGACAGTAGGTTCGGTGACTTATCAGTTGAGAGGAATTTAATTTCGGATGAGTCTAAGCCCTCCACTTCTCTTATGAATCTACCTAATAATTCTAAGTTGACAAGATCTACTGGGGAAAACTATGATAGAAAAACATATGGAAAGAGTAGTGGTGTCAAGGATATCGGTTCATCTTGTGCTAAAGGAAAGGGAAGTTGGCAGTTACCTTCCAAGAAGATTCCAGGAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

279

Amino Acids

31.98

Weight (kDa)

8.55

Isoelectric Point (pI)

48.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 111
AclWI GGATC 4 cut(s) 45, 77, 159, 276
AcsI RAATTY 4 cut(s) 215, 418, 517, 643
AfaI GTAC 3 cut(s) 64, 175, 292
AflIII ACRYGT 2 cut(s) 76, 187
AgsI TTSAA 2 cut(s) 447, 563
AjnI CCWGG 2 cut(s) 458, 829
AjuI GAANNNNNNNTTGG 2 cut(s) 787, 819
AluBI AGCT 7 cut(s) 19, 31, 251, 273, 402, 429, 583
AluI AGCT 7 cut(s) 19, 31, 251, 273, 402, 429, 583
Alw26I GTCTC 2 cut(s) 369, 586
AlwI GGATC 4 cut(s) 45, 77, 159, 276
AoxI GGCC 1 cut(s) 461
ApoI RAATTY 4 cut(s) 215, 418, 517, 643
ArsI GACNNNNNNTTYG 2 cut(s) 602, 634
AspS9I GGNCC 3 cut(s) 148, 265, 462
AsuHPI GGTGA 3 cut(s) 414, 577, 635
AvaII GGWCC 2 cut(s) 148, 265
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 2 cut(s) 460, 831
BcoDI GTCTC 2 cut(s) 369, 586
BfaI CTAG 5 cut(s) 32, 222, 314, 426, 552
BfmI CTRYAG 3 cut(s) 46, 157, 274
BglII AGATCT 1 cut(s) 713
BmcAI AGTACT 1 cut(s) 175
Bme1390I CCNGG 2 cut(s) 460, 831
Bme18I GGWCC 2 cut(s) 148, 265
BmgT120I GGNCC 3 cut(s) 148, 265, 462
BmiI GGNNCC 1 cut(s) 495
BmrFI CCNGG 2 cut(s) 460, 831
BmrI ACTGGG 1 cut(s) 729
BmsI GCATC 1 cut(s) 373
BmuI ACTGGG 1 cut(s) 729
BpmI CTGGAG 1 cut(s) 231
BsaI GGTCTC 1 cut(s) 369
BsaJI CCNNGG 2 cut(s) 66, 294
Bse1I ACTGG 1 cut(s) 724
BseBI CCWGG 2 cut(s) 460, 831
BseDI CCNNGG 2 cut(s) 66, 294
BseGI GGATG 3 cut(s) 121, 613, 661
BseMII CTCAG 1 cut(s) 480
BseNI ACTGG 1 cut(s) 724
BshFI GGCC 1 cut(s) 463
BsmAI GTCTC 2 cut(s) 369, 586
BsmI GAATGC 1 cut(s) 211
BsnI GGCC 1 cut(s) 463
Bso31I GGTCTC 1 cut(s) 369
Bsp143I GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
BspANI GGCC 1 cut(s) 463
BspCNI CTCAG 1 cut(s) 479
BspLI GGNNCC 1 cut(s) 495
BspPI GGATC 4 cut(s) 45, 77, 159, 276
BspTNI GGTCTC 1 cut(s) 369
BsrI ACTGG 1 cut(s) 724
BssECI CCNNGG 2 cut(s) 66, 294
BssMI GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
BssT1I CCWWGG 1 cut(s) 294
Bst2UI CCWGG 2 cut(s) 460, 831
Bst4CI ACNGT 1 cut(s) 614
BstC8I GCNNGC 1 cut(s) 400
BstDEI CTNAG 4 cut(s) 177, 466, 663, 702
BstDSI CCRYGG 1 cut(s) 66
BstF5I GGATG 3 cut(s) 121, 613, 661
BstKTI GATC 8 cut(s) 40, 85, 167, 196, 284, 313, 454, 716
BstMAI GTCTC 2 cut(s) 369, 586
BstMBI GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
BstNI CCWGG 2 cut(s) 460, 831
BstNSI RCATGY 2 cut(s) 80, 191
BstSCI CCNGG 2 cut(s) 458, 829
BstSFI CTRYAG 3 cut(s) 46, 157, 274
BstX2I RGATCY 3 cut(s) 164, 281, 713
BstYI RGATCY 3 cut(s) 164, 281, 713
BsuRI GGCC 1 cut(s) 463
BtgI CCRYGG 1 cut(s) 66
BtsCI GGATG 3 cut(s) 121, 613, 661
Cac8I GCNNGC 1 cut(s) 400
Cfr13I GGNCC 3 cut(s) 148, 265, 462
Csp6I GTAC 3 cut(s) 63, 174, 291
CviAII CATG 4 cut(s) 77, 188, 334, 377
CviQI GTAC 3 cut(s) 63, 174, 291
DdeI CTNAG 4 cut(s) 177, 466, 663, 702
DpnI GATC 8 cut(s) 39, 84, 166, 195, 283, 312, 453, 715
DpnII GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
Eco130I CCWWGG 1 cut(s) 294
Eco31I GGTCTC 1 cut(s) 369
Eco32I GATATC 1 cut(s) 772
Eco47I GGWCC 2 cut(s) 148, 265
EcoO109I RGGNCCY 1 cut(s) 462
EcoRI GAATTC 2 cut(s) 215, 418
EcoRII CCWGG 2 cut(s) 458, 829
EcoRV GATATC 1 cut(s) 772
EcoT14I CCWWGG 1 cut(s) 294
ErhI CCWWGG 1 cut(s) 294
FaeI CATG 4 cut(s) 80, 191, 337, 380
FatI CATG 4 cut(s) 76, 187, 333, 376
FauNDI CATATG 1 cut(s) 745
FokI GGATG 3 cut(s) 128, 620, 668
FspBI CTAG 5 cut(s) 32, 222, 314, 426, 552
GsuI CTGGAG 1 cut(s) 231
HaeIII GGCC 1 cut(s) 463
Hin1II CATG 4 cut(s) 80, 191, 337, 380
HincII GTYRAC 1 cut(s) 708
HindII GTYRAC 1 cut(s) 708
HinfI GANTC 4 cut(s) 389, 659, 685, 826
HphI GGTGA 3 cut(s) 414, 577, 635
Hpy166II GTNNAC 2 cut(s) 371, 708
Hpy188I TCNGA 1 cut(s) 655
Hpy188III TCNNGA 7 cut(s) 57, 86, 168, 285, 314, 552, 560
Hpy8I GTNNAC 2 cut(s) 371, 708
HpyAV CCTTC 2 cut(s) 533, 825
HpyCH4III ACNGT 1 cut(s) 614
HpyCH4V TGCA 2 cut(s) 386, 398
HpyF3I CTNAG 4 cut(s) 177, 466, 663, 702
Hsp92II CATG 4 cut(s) 80, 191, 337, 380
Kzo9I GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
LpnPI CCDG 7 cut(s) 70, 99, 195, 445, 472, 705, 816
LweI GCATC 1 cut(s) 373
MaeI CTAG 5 cut(s) 32, 222, 314, 426, 552
MaeIII GTNAC 3 cut(s) 404, 623, 810
MalI GATC 8 cut(s) 39, 84, 166, 195, 283, 312, 453, 715
MboI GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
MboII GAAGA 1 cut(s) 835
MflI RGATCY 3 cut(s) 164, 281, 713
MluCI AATT 8 cut(s) 215, 418, 479, 517, 597, 643, 648, 697
MlyI GAGTC 2 cut(s) 383, 668
MnlI CCTC 8 cut(s) 28, 139, 256, 408, 475, 529, 633, 679
MseI TTAA 3 cut(s) 482, 530, 647
MslI CAYNNNNRTG 1 cut(s) 381
MspR9I CCNGG 2 cut(s) 460, 831
Mva1269I GAATGC 1 cut(s) 211
MvaI CCWGG 2 cut(s) 460, 831
NdeI CATATG 1 cut(s) 745
NdeII GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
NlaIII CATG 4 cut(s) 80, 191, 337, 380
NlaIV GGNNCC 1 cut(s) 495
NmuCI GTSAC 1 cut(s) 623
NspI RCATGY 2 cut(s) 80, 191
PciI ACATGT 2 cut(s) 76, 187
PctI GAATGC 1 cut(s) 211
PfeI GAWTC 2 cut(s) 685, 826
PfoI TCCNGGA 1 cut(s) 829
PleI GAGTC 2 cut(s) 383, 667
PpsI GAGTC 2 cut(s) 383, 667
PscI ACATGT 2 cut(s) 76, 187
PsiI TTATAA 1 cut(s) 111
Psp6I CCWGG 2 cut(s) 458, 829
PspGI CCWGG 2 cut(s) 458, 829
PspN4I GGNNCC 1 cut(s) 495
PspPI GGNCC 3 cut(s) 148, 265, 462
PsuI RGATCY 3 cut(s) 164, 281, 713
RsaI GTAC 3 cut(s) 64, 175, 292
RsaNI GTAC 3 cut(s) 63, 174, 291
RseI CAYNNNNRTG 1 cut(s) 381
SaqAI TTAA 3 cut(s) 482, 530, 647
Sau3AI GATC 8 cut(s) 37, 82, 164, 193, 281, 310, 451, 713
Sau96I GGNCC 3 cut(s) 148, 265, 462
ScaI AGTACT 1 cut(s) 175
SchI GAGTC 2 cut(s) 383, 668
ScrFI CCNGG 2 cut(s) 460, 831
SfaNI GCATC 1 cut(s) 373
SfcI CTRYAG 3 cut(s) 46, 157, 274
SinI GGWCC 2 cut(s) 148, 265
SmiMI CAYNNNNRTG 1 cut(s) 381
Sse9I AATT 8 cut(s) 215, 418, 479, 517, 597, 643, 648, 697
SspMI CTAG 5 cut(s) 32, 222, 314, 426, 552
StyD4I CCNGG 2 cut(s) 458, 829
StyI CCWWGG 1 cut(s) 294
TaaI ACNGT 1 cut(s) 614
TaqII GACCGA 1 cut(s) 282
TasI AATT 8 cut(s) 215, 418, 479, 517, 597, 643, 648, 697
TatI WGTACW 1 cut(s) 173
TfiI GAWTC 2 cut(s) 685, 826
Tru1I TTAA 3 cut(s) 482, 530, 647
Tru9I TTAA 3 cut(s) 482, 530, 647
TseFI GTSAC 1 cut(s) 623
Tsp45I GTSAC 1 cut(s) 623
TspDTI ATGAA 2 cut(s) 698, 768
TspGWI ACGGA 1 cut(s) 83
VpaK11BI GGWCC 2 cut(s) 148, 265
XapI RAATTY 4 cut(s) 215, 418, 517, 643
XbaI TCTAGA 2 cut(s) 313, 551
XceI RCATGY 2 cut(s) 80, 191
XspI CTAG 5 cut(s) 32, 222, 314, 426, 552
ZrmI AGTACT 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.